Incidental Mutation 'R4474:Kcna4'
ID330475
Institutional Source Beutler Lab
Gene Symbol Kcna4
Ensembl Gene ENSMUSG00000042604
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 4
SynonymsKv1.4
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4474 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location107290639-107298502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107296007 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 362 (N362S)
Ref Sequence ENSEMBL: ENSMUSP00000037958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037012]
Predicted Effect probably benign
Transcript: ENSMUST00000037012
AA Change: N362S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037958
Gene: ENSMUSG00000042604
AA Change: N362S

DomainStartEndE-ValueType
Pfam:K_channel_TID 1 74 1.5e-42 PFAM
low complexity region 77 89 N/A INTRINSIC
coiled coil region 112 139 N/A INTRINSIC
low complexity region 160 166 N/A INTRINSIC
BTB 177 277 1.67e-8 SMART
Pfam:Ion_trans 307 572 2.8e-51 PFAM
Pfam:Ion_trans_2 480 565 9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173191
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the A-type potassium current class, the members of which may be important in the regulation of the fast repolarizing phase of action potentials in heart and thus may influence the duration of cardiac action potential.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal; however, a small subset of mutants exhibit spontaneous seizure activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Snx31 A G 15: 36,546,111 probably benign Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Kcna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kcna4 APN 2 107295862 missense probably damaging 1.00
IGL01025:Kcna4 APN 2 107296391 missense probably damaging 0.99
IGL01433:Kcna4 APN 2 107296733 missense probably damaging 0.99
IGL01805:Kcna4 APN 2 107296498 missense probably damaging 1.00
IGL02121:Kcna4 APN 2 107296618 missense possibly damaging 0.92
Pinched UTSW 2 107296549 missense probably damaging 1.00
PIT4377001:Kcna4 UTSW 2 107296860 missense possibly damaging 0.83
R0255:Kcna4 UTSW 2 107296562 missense probably damaging 1.00
R0650:Kcna4 UTSW 2 107295582 nonsense probably null
R0761:Kcna4 UTSW 2 107296072 missense probably benign 0.02
R1211:Kcna4 UTSW 2 107295315 small deletion probably benign
R1553:Kcna4 UTSW 2 107296687 missense probably benign 0.02
R1854:Kcna4 UTSW 2 107296484 missense probably damaging 1.00
R1915:Kcna4 UTSW 2 107296778 missense probably benign 0.01
R1974:Kcna4 UTSW 2 107296220 missense possibly damaging 0.65
R4002:Kcna4 UTSW 2 107295914 missense probably damaging 1.00
R4163:Kcna4 UTSW 2 107295806 missense probably damaging 1.00
R4413:Kcna4 UTSW 2 107295373 missense probably benign 0.01
R4492:Kcna4 UTSW 2 107296091 missense probably damaging 1.00
R4525:Kcna4 UTSW 2 107295065 missense possibly damaging 0.93
R4766:Kcna4 UTSW 2 107296543 missense probably damaging 1.00
R4787:Kcna4 UTSW 2 107296468 missense probably damaging 1.00
R5423:Kcna4 UTSW 2 107295806 nonsense probably null
R5725:Kcna4 UTSW 2 107296876 missense possibly damaging 0.48
R6381:Kcna4 UTSW 2 107294972 missense probably benign 0.05
R6399:Kcna4 UTSW 2 107296549 missense probably damaging 1.00
R6787:Kcna4 UTSW 2 107295325 missense possibly damaging 0.91
R6891:Kcna4 UTSW 2 107296307 missense probably damaging 1.00
R7057:Kcna4 UTSW 2 107295320 missense probably damaging 0.96
R7250:Kcna4 UTSW 2 107296318 missense possibly damaging 0.92
R7522:Kcna4 UTSW 2 107296255 missense probably damaging 1.00
R7799:Kcna4 UTSW 2 107295892 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGCCAGGGGTATAGCCATTG -3'
(R):5'- CCAGACGAATGATCCTAAGGATG -3'

Sequencing Primer
(F):5'- ATAGCCATTGTGTCTGTCCTG -3'
(R):5'- CAAAGGACATGGCCTGCTG -3'
Posted On2015-07-21