Incidental Mutation 'R9098:Syt6'
ID 691461
Institutional Source Beutler Lab
Gene Symbol Syt6
Ensembl Gene ENSMUSG00000027849
Gene Name synaptotagmin VI
Synonyms 3110037A08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # R9098 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 103575231-103645569 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103585579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 134 (I134T)
Ref Sequence ENSEMBL: ENSMUSP00000112997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985] [ENSMUST00000183637]
AlphaFold Q9R0N8
Predicted Effect probably damaging
Transcript: ENSMUST00000090697
AA Change: I134T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: I134T

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117221
AA Change: I49T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: I49T

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118117
AA Change: I49T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: I49T

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118563
AA Change: I49T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849
AA Change: I49T

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
Pfam:C2 294 332 3.5e-2 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121834
AA Change: I134T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: I134T

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132325
SMART Domains Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136049
SMART Domains Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151985
Predicted Effect probably damaging
Transcript: ENSMUST00000183637
AA Change: I49T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138874
Gene: ENSMUSG00000027849
AA Change: I49T

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik T C 6: 73,469,534 T11A probably benign Het
A830018L16Rik A T 1: 11,562,987 D168V probably damaging Het
Abcb4 A T 5: 8,958,441 D1203V probably damaging Het
Acat2 G A 17: 12,960,092 probably benign Het
Adam3 C T 8: 24,689,468 C611Y probably damaging Het
Adgrb1 A G 15: 74,543,340 D638G probably damaging Het
Adra1b T C 11: 43,776,391 N340D probably damaging Het
Ankrd31 A G 13: 96,780,371 H131R probably damaging Het
Aoc2 T C 11: 101,326,338 S416P possibly damaging Het
Armc8 G A 9: 99,505,309 R419* probably null Het
Atp6v1h T G 1: 5,093,415 V90G probably damaging Het
Avl9 T C 6: 56,730,643 V191A probably benign Het
Bsn G A 9: 108,112,974 P1860S possibly damaging Het
Btd A G 14: 31,662,276 K73R probably benign Het
Cd22 T C 7: 30,867,966 K731R probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Chmp7 C A 14: 69,719,462 L332F probably damaging Het
Cldn11 A G 3: 31,163,127 E148G probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cnbd1 A T 4: 18,886,061 Y319* probably null Het
Cnnm4 A G 1: 36,472,089 T133A probably benign Het
Cpeb4 A T 11: 31,872,679 E131V probably benign Het
Ctns A G 11: 73,187,735 probably null Het
Dhx36 C A 3: 62,506,720 E74* probably null Het
Dhx36 C A 3: 62,506,721 Q73H probably benign Het
Dnah5 A G 15: 28,419,961 T3802A Het
Fbxo31 G A 8: 121,554,397 R337C probably damaging Het
Flnc C T 6: 29,455,519 Q2056* probably null Het
Fmo9 T C 1: 166,664,630 D408G possibly damaging Het
Gm13088 A T 4: 143,654,527 Y309N probably benign Het
Gm14412 T A 2: 177,314,563 H513L probably damaging Het
Gm21663 G C 5: 25,942,169 C46W probably benign Het
Gm29776 T G 14: 54,695,229 S393R probably damaging Het
Gucy1a2 A T 9: 3,634,489 I178L probably benign Het
Htr1b A T 9: 81,632,428 L42Q Het
Htr2b T C 1: 86,099,759 T342A probably damaging Het
Jph2 C T 2: 163,339,553 V564M probably damaging Het
Kcnmb1 A G 11: 33,964,806 T36A probably damaging Het
Krit1 A C 5: 3,813,135 K310N probably benign Het
Lama1 C T 17: 67,804,513 T2253M Het
Lpar6 C T 14: 73,238,793 L65F probably damaging Het
Megf6 G A 4: 154,269,703 G1355R probably damaging Het
Mkl2 A G 16: 13,403,189 H743R probably benign Het
Mmp3 T A 9: 7,446,936 Y39N probably damaging Het
Ms4a18 C A 19: 11,013,377 V118F Het
Mthfr G A 4: 148,041,625 S51N probably benign Het
Muc16 T A 9: 18,643,679 T3773S unknown Het
Mus81 T A 19: 5,484,004 K400* probably null Het
Naaladl2 A T 3: 24,433,180 D192E probably benign Het
Naip5 T C 13: 100,229,619 D329G possibly damaging Het
Nek11 T A 9: 105,293,657 H393L probably benign Het
Nmur2 T C 11: 56,029,582 D279G possibly damaging Het
Nol4l C A 2: 153,470,710 R226L probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr961 A G 9: 39,647,083 D119G probably damaging Het
Olfr97 T C 17: 37,232,070 Y100C probably benign Het
Olfr992 T C 2: 85,399,651 N294S probably damaging Het
Palm A G 10: 79,819,154 T249A probably benign Het
Rhobtb3 A G 13: 75,939,583 I95T probably damaging Het
Rnpep A T 1: 135,278,821 F178L possibly damaging Het
Rsl1d1 A G 16: 11,201,363 S105P probably damaging Het
Rxra C T 2: 27,748,744 T253I possibly damaging Het
Schip1 A G 3: 68,064,985 D15G Het
Sis T A 3: 72,937,245 I719F possibly damaging Het
Snx18 A G 13: 113,617,774 S208P probably benign Het
Srcap T C 7: 127,552,644 V2125A probably damaging Het
Stx7 C T 10: 24,182,826 Q199* probably null Het
Tlr12 A G 4: 128,617,077 M460T probably benign Het
Tnni3k T C 3: 154,941,677 T398A possibly damaging Het
Tspan4 T C 7: 141,491,903 S188P probably benign Het
Ubap2l A G 3: 90,002,449 S1025P unknown Het
Ubl7 A G 9: 57,921,752 D219G probably benign Het
Vmn2r115 C A 17: 23,345,829 T230K probably benign Het
Vmn2r95 T A 17: 18,439,905 M193K possibly damaging Het
Zfp639 A G 3: 32,519,736 E170G probably damaging Het
Zfy1 A G Y: 725,987 S593P possibly damaging Het
Zscan4-ps1 T A 7: 11,065,568 T465S probably damaging Het
Other mutations in Syt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Syt6 APN 3 103625626 missense probably damaging 0.98
IGL02944:Syt6 APN 3 103575549 unclassified probably benign
IGL03168:Syt6 APN 3 103587627 missense probably damaging 1.00
PIT4305001:Syt6 UTSW 3 103575453 missense possibly damaging 0.91
R0124:Syt6 UTSW 3 103587526 missense probably damaging 1.00
R0587:Syt6 UTSW 3 103625571 missense probably damaging 0.99
R0601:Syt6 UTSW 3 103620890 missense probably damaging 1.00
R1262:Syt6 UTSW 3 103585340 critical splice acceptor site probably null
R1970:Syt6 UTSW 3 103587420 missense probably benign 0.21
R4012:Syt6 UTSW 3 103625493 splice site probably benign
R4450:Syt6 UTSW 3 103585645 missense probably benign 0.01
R4493:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4494:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4495:Syt6 UTSW 3 103587560 nonsense probably null
R4740:Syt6 UTSW 3 103625656 missense probably damaging 1.00
R4750:Syt6 UTSW 3 103630917 makesense probably null
R5668:Syt6 UTSW 3 103620901 missense probably damaging 1.00
R6185:Syt6 UTSW 3 103585528 missense probably damaging 1.00
R6660:Syt6 UTSW 3 103625644 missense probably damaging 1.00
R7120:Syt6 UTSW 3 103587357 missense probably damaging 1.00
R7307:Syt6 UTSW 3 103587472 missense probably damaging 1.00
R7501:Syt6 UTSW 3 103587702 missense probably benign 0.01
R8768:Syt6 UTSW 3 103585534 missense probably benign
R8867:Syt6 UTSW 3 103627055 missense possibly damaging 0.91
R8885:Syt6 UTSW 3 103625625 missense probably benign 0.06
R9068:Syt6 UTSW 3 103587509 nonsense probably null
R9361:Syt6 UTSW 3 103575363 unclassified probably benign
Z1177:Syt6 UTSW 3 103645115 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTCGCCGTGGTAGTTATTG -3'
(R):5'- ATCAGAAAGTATGGCTGCACGG -3'

Sequencing Primer
(F):5'- CCCTGGTGGCAGTTTTTCTC -3'
(R):5'- TATGGCTGCACGGAGGGG -3'
Posted On 2021-12-30