Incidental Mutation 'R4483:Rpl31-ps17'
ID 331502
Institutional Source Beutler Lab
Gene Symbol Rpl31-ps17
Ensembl Gene ENSMUSG00000072255
Gene Name ribosomal protein L31, pseudogene 17
Synonyms Gm16382
MMRRC Submission 041739-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R4483 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 54748114-54748491 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 54748397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179621
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,567,349 (GRCm39) G5275S probably benign Het
Akap11 A G 14: 78,747,699 (GRCm39) S1563P probably damaging Het
Ankrd50 A G 3: 38,511,680 (GRCm39) V229A probably damaging Het
AW112010 A G 19: 11,027,757 (GRCm39) noncoding transcript Het
Ccdc158 A G 5: 92,781,187 (GRCm39) S873P probably benign Het
Cep350 A G 1: 155,802,214 (GRCm39) V1104A probably benign Het
Chil4 G A 3: 106,121,678 (GRCm39) A57V probably damaging Het
Cpa5 A G 6: 30,624,625 (GRCm39) E155G probably damaging Het
Ctsq T C 13: 61,186,726 (GRCm39) I93V probably benign Het
Dbi A T 1: 120,048,535 (GRCm39) I37K probably benign Het
Defa35 T C 8: 21,555,208 (GRCm39) S43P probably damaging Het
Fance T A 17: 28,534,781 (GRCm39) probably benign Het
Fbxl6 A G 15: 76,422,129 (GRCm39) L180P probably damaging Het
Fkbpl T C 17: 34,865,269 (GRCm39) F346L probably damaging Het
Gm11735 C A 11: 116,632,101 (GRCm39) noncoding transcript Het
Gm28042 T C 2: 119,866,321 (GRCm39) I373T possibly damaging Het
Golga4 T C 9: 118,343,254 (GRCm39) S27P probably damaging Het
Gstm1 C T 3: 107,923,834 (GRCm39) probably null Het
Lama3 T A 18: 12,682,310 (GRCm39) I1092K probably benign Het
Med15 A T 16: 17,489,428 (GRCm39) probably benign Het
Nlrp6 A G 7: 140,501,694 (GRCm39) D87G probably damaging Het
Parp11 A G 6: 127,448,568 (GRCm39) T62A probably benign Het
Pcnt A G 10: 76,237,317 (GRCm39) L1323S probably damaging Het
Ppp2r1a C T 17: 21,176,072 (GRCm39) T98I probably benign Het
Pramel11 T A 4: 143,622,410 (GRCm39) Y315F probably damaging Het
Prl7a2 T A 13: 27,844,930 (GRCm39) H152L possibly damaging Het
Rnf145 T C 11: 44,455,104 (GRCm39) S662P probably benign Het
Tnfaip3 A T 10: 18,887,375 (GRCm39) M50K probably damaging Het
Txlnb T TTA 10: 17,714,745 (GRCm39) probably null Het
Usp9x A G X: 12,987,687 (GRCm39) D638G possibly damaging Het
Vmn1r30 A T 6: 58,412,118 (GRCm39) V238E probably damaging Het
Zfp507 A G 7: 35,487,141 (GRCm39) probably null Het
Zfp532 G T 18: 65,789,636 (GRCm39) W1025L probably benign Het
Other mutations in Rpl31-ps17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2174:Rpl31-ps17 UTSW 12 54,748,397 (GRCm39) unclassified noncoding transcript
R3620:Rpl31-ps17 UTSW 12 54,748,397 (GRCm39) unclassified noncoding transcript
R3861:Rpl31-ps17 UTSW 12 54,748,397 (GRCm39) unclassified noncoding transcript
R4156:Rpl31-ps17 UTSW 12 54,748,397 (GRCm39) unclassified noncoding transcript
R4157:Rpl31-ps17 UTSW 12 54,748,397 (GRCm39) unclassified noncoding transcript
R4194:Rpl31-ps17 UTSW 12 54,748,434 (GRCm39) unclassified noncoding transcript
R4205:Rpl31-ps17 UTSW 12 54,748,397 (GRCm39) unclassified noncoding transcript
R4423:Rpl31-ps17 UTSW 12 54,748,397 (GRCm39) unclassified noncoding transcript
R4424:Rpl31-ps17 UTSW 12 54,748,397 (GRCm39) unclassified noncoding transcript
R4455:Rpl31-ps17 UTSW 12 54,748,397 (GRCm39) unclassified noncoding transcript
R4457:Rpl31-ps17 UTSW 12 54,748,397 (GRCm39) unclassified noncoding transcript
R4776:Rpl31-ps17 UTSW 12 54,748,397 (GRCm39) unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGGACAAGCGTACTCGGATG -3'
(R):5'- AAGATAGTTTTCTCGGCCCGTTTC -3'

Sequencing Primer
(F):5'- TACTCGGATGCGATATGGAACGTTC -3'
(R):5'- TCAGGCAGCAGTATATAGTTAAAAAC -3'
Posted On 2015-07-21