Incidental Mutation 'R4483:Ccdc158'
ID331491
Institutional Source Beutler Lab
Gene Symbol Ccdc158
Ensembl Gene ENSMUSG00000050050
Gene Namecoiled-coil domain containing 158
Synonyms4932413O14Rik
MMRRC Submission 041739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R4483 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92607954-92675271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92633328 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 873 (S873P)
Ref Sequence ENSEMBL: ENSMUSP00000063050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060930]
Predicted Effect probably benign
Transcript: ENSMUST00000060930
AA Change: S873P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000063050
Gene: ENSMUSG00000050050
AA Change: S873P

DomainStartEndE-ValueType
Pfam:CCDC158 1 1109 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212060
Meta Mutation Damage Score 0.0905 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,419,230 G5275S probably benign Het
Akap11 A G 14: 78,510,259 S1563P probably damaging Het
Ankrd50 A G 3: 38,457,531 V229A probably damaging Het
AW112010 A G 19: 11,050,393 noncoding transcript Het
Cep350 A G 1: 155,926,468 V1104A probably benign Het
Chil4 G A 3: 106,214,362 A57V probably damaging Het
Cpa5 A G 6: 30,624,626 E155G probably damaging Het
Ctsq T C 13: 61,038,912 I93V probably benign Het
Dbi A T 1: 120,120,805 I37K probably benign Het
Defa35 T C 8: 21,065,192 S43P probably damaging Het
Fance T A 17: 28,315,807 probably benign Het
Fbxl6 A G 15: 76,537,929 L180P probably damaging Het
Fkbpl T C 17: 34,646,295 F346L probably damaging Het
Gm11735 C A 11: 116,741,275 noncoding transcript Het
Gm28042 T C 2: 120,035,840 I373T possibly damaging Het
Golga4 T C 9: 118,514,186 S27P probably damaging Het
Gstm1 C T 3: 108,016,518 probably null Het
Lama3 T A 18: 12,549,253 I1092K probably benign Het
Med15 A T 16: 17,671,564 probably benign Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Parp11 A G 6: 127,471,605 T62A probably benign Het
Pcnt A G 10: 76,401,483 L1323S probably damaging Het
Ppp2r1a C T 17: 20,955,810 T98I probably benign Het
Pramef6 T A 4: 143,895,840 Y315F probably damaging Het
Prl7a2 T A 13: 27,660,947 H152L possibly damaging Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Tnfaip3 A T 10: 19,011,627 M50K probably damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp9x A G X: 13,121,448 D638G possibly damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Zfp507 A G 7: 35,787,716 probably null Het
Zfp532 G T 18: 65,656,565 W1025L probably benign Het
Other mutations in Ccdc158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ccdc158 APN 5 92657881 missense probably benign 0.01
IGL00926:Ccdc158 APN 5 92650767 missense probably damaging 0.98
IGL01533:Ccdc158 APN 5 92609956 splice site probably null
IGL01551:Ccdc158 APN 5 92666761 missense probably damaging 0.96
IGL01591:Ccdc158 APN 5 92662041 missense probably benign 0.28
IGL01722:Ccdc158 APN 5 92662739 missense possibly damaging 0.93
IGL02250:Ccdc158 APN 5 92608478 missense probably damaging 1.00
IGL02457:Ccdc158 APN 5 92650048 missense probably damaging 1.00
IGL02570:Ccdc158 APN 5 92649026 missense possibly damaging 0.81
IGL02951:Ccdc158 APN 5 92650006 missense probably damaging 1.00
IGL03275:Ccdc158 APN 5 92629632 missense probably benign 0.00
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0747:Ccdc158 UTSW 5 92633297 missense probably benign 0.00
R1219:Ccdc158 UTSW 5 92654181 splice site probably benign
R1480:Ccdc158 UTSW 5 92649044 missense probably damaging 1.00
R1926:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R2172:Ccdc158 UTSW 5 92632508 missense probably damaging 1.00
R2245:Ccdc158 UTSW 5 92609952 unclassified probably benign
R3004:Ccdc158 UTSW 5 92649070 missense probably damaging 1.00
R3147:Ccdc158 UTSW 5 92657963 missense probably damaging 1.00
R3693:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3694:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3735:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3736:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3912:Ccdc158 UTSW 5 92648935 missense possibly damaging 0.90
R4026:Ccdc158 UTSW 5 92643807 missense probably benign 0.07
R4080:Ccdc158 UTSW 5 92623396 missense probably benign 0.00
R4463:Ccdc158 UTSW 5 92634300 missense probably null 0.99
R4859:Ccdc158 UTSW 5 92633403 missense probably damaging 0.99
R5016:Ccdc158 UTSW 5 92657892 missense probably benign 0.01
R5050:Ccdc158 UTSW 5 92666879 missense probably benign 0.01
R5372:Ccdc158 UTSW 5 92632560 missense possibly damaging 0.55
R5427:Ccdc158 UTSW 5 92648962 missense probably damaging 1.00
R5847:Ccdc158 UTSW 5 92627480 missense probably benign 0.00
R5966:Ccdc158 UTSW 5 92650049 missense probably damaging 1.00
R6106:Ccdc158 UTSW 5 92627466 missense probably benign
R6185:Ccdc158 UTSW 5 92666854 missense possibly damaging 0.73
R6562:Ccdc158 UTSW 5 92662722 missense probably damaging 0.99
R6743:Ccdc158 UTSW 5 92662146 missense probably benign 0.08
R6815:Ccdc158 UTSW 5 92612486 missense probably damaging 0.99
R6914:Ccdc158 UTSW 5 92662070 missense probably benign 0.00
R6975:Ccdc158 UTSW 5 92666720 nonsense probably null
R7252:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R7477:Ccdc158 UTSW 5 92650696 missense probably damaging 0.96
R7782:Ccdc158 UTSW 5 92645514 missense probably benign 0.00
R8014:Ccdc158 UTSW 5 92649030 missense probably damaging 1.00
R8018:Ccdc158 UTSW 5 92623401 missense possibly damaging 0.64
X0025:Ccdc158 UTSW 5 92662012 missense probably benign
Z1176:Ccdc158 UTSW 5 92608491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACATCTTCAGAGAAAGCCTG -3'
(R):5'- TCTACGTGACAGTGAAACATCTC -3'

Sequencing Primer
(F):5'- CAGATTTCTGAGTTCAAGGCCAGC -3'
(R):5'- ACATCTCTTCTTAAAAAGGGTGC -3'
Posted On2015-07-21