Incidental Mutation 'R4502:Cand1'
ID331867
Institutional Source Beutler Lab
Gene Symbol Cand1
Ensembl Gene ENSMUSG00000020114
Gene Namecullin associated and neddylation disassociated 1
SynonymsD10Ertd516e, 2310038O07Rik, 6330512O03Rik
MMRRC Submission 041754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4502 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location119199255-119240055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119216667 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 185 (T185A)
Ref Sequence ENSEMBL: ENSMUSP00000115234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020315] [ENSMUST00000126373]
Predicted Effect probably benign
Transcript: ENSMUST00000020315
AA Change: T178A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020315
Gene: ENSMUSG00000020114
AA Change: T178A

DomainStartEndE-ValueType
SCOP:d1qgra_ 53 994 4e-44 SMART
Pfam:TIP120 1040 1203 1.9e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126373
AA Change: T185A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115234
Gene: ENSMUSG00000020114
AA Change: T185A

DomainStartEndE-ValueType
Pfam:HEAT 56 86 2.1e-5 PFAM
low complexity region 124 135 N/A INTRINSIC
Pfam:HEAT_EZ 155 209 3.7e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149155
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of Cullin-RING ubiquitin ligases, which are in involved in ubiquitinylation of proteins degraded by the Ub proteasome system. The encoded protein binds to unneddylated cullin-RING box protein complexes and acts as an inhibitor of cullin neddylation and of Skp1, cullin, and F box ubiquitin ligase complex assembly and activity. In mammalian cell culture, this protein predominantly localizes to the cytoplasm. Knockdown of this gene in preadipocytes results in blocked adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b A C 3: 20,315,798 Y215D probably damaging Het
Arf5 T C 6: 28,425,776 V123A possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atm A G 9: 53,495,946 V1164A possibly damaging Het
Atp6v0d1 A G 8: 105,565,798 C39R probably damaging Het
Bmp8a T A 4: 123,342,399 S104C probably damaging Het
Ccdc171 A G 4: 83,864,323 E1284G probably damaging Het
Chodl A G 16: 78,931,444 S26G possibly damaging Het
Cic C T 7: 25,288,467 P620S probably damaging Het
Col3a1 T C 1: 45,348,677 probably benign Het
Dirc2 T C 16: 35,719,417 M345V probably benign Het
Dpyd G T 3: 118,797,537 G225C probably damaging Het
Dst G A 1: 34,247,691 V5560M probably damaging Het
Eea1 G A 10: 96,039,565 E1233K probably benign Het
Fryl T C 5: 73,088,397 D1139G probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hc T C 2: 35,006,252 D1173G probably benign Het
Htr2a T A 14: 74,641,988 M19K probably benign Het
Kank4 G A 4: 98,777,098 S653L possibly damaging Het
Kcnt2 G T 1: 140,507,747 C484F probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klhl1 A G 14: 96,517,846 S158P probably benign Het
Ldb2 T C 5: 44,669,407 D62G probably damaging Het
Ldhb T C 6: 142,490,457 K329E possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Olfr1370 A T 13: 21,072,746 I185N probably damaging Het
Olfr178 T C 16: 58,890,176 I15V probably benign Het
Olfr303 T A 7: 86,395,277 T74S possibly damaging Het
Pi4kb T A 3: 94,996,607 H501Q probably benign Het
Ppargc1b T C 18: 61,302,679 K910R probably benign Het
Ppp1r12a G T 10: 108,249,478 R428I probably benign Het
Rbbp8nl G T 2: 180,279,196 T465N possibly damaging Het
Rpl5 T C 5: 107,904,857 F223S possibly damaging Het
Scpep1 T C 11: 88,944,385 K154R probably benign Het
Sil1 T C 18: 35,317,875 Y249C probably benign Het
Slc12a1 T A 2: 125,226,044 L1017Q probably damaging Het
Slc2a9 T C 5: 38,398,811 N264S probably benign Het
Tdrd5 T A 1: 156,300,764 M141L probably benign Het
Tdrd9 T C 12: 111,993,825 C182R probably damaging Het
Thap4 T C 1: 93,750,987 probably null Het
Tmem131 T C 1: 36,825,479 T558A probably benign Het
Tnks1bp1 C T 2: 85,062,647 R973* probably null Het
Ulk3 A G 9: 57,593,229 Y307C probably damaging Het
Usp25 T C 16: 77,115,396 L1001P probably damaging Het
Vmn2r80 A T 10: 79,148,930 T39S probably benign Het
Vps33b G A 7: 80,287,907 A468T possibly damaging Het
Wnt9a T C 11: 59,328,537 S130P probably damaging Het
Zfp236 T C 18: 82,636,954 E730G probably benign Het
Zfp689 C A 7: 127,448,753 V36L probably benign Het
Zfp938 A G 10: 82,226,271 S172P possibly damaging Het
Other mutations in Cand1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cand1 APN 10 119211135 missense probably benign 0.00
IGL00917:Cand1 APN 10 119210936 missense possibly damaging 0.87
IGL01383:Cand1 APN 10 119208167 missense probably damaging 0.96
IGL02016:Cand1 APN 10 119212568 missense probably damaging 0.98
IGL02271:Cand1 APN 10 119211721 missense probably damaging 1.00
IGL02282:Cand1 APN 10 119210709 missense probably benign 0.26
IGL02494:Cand1 APN 10 119213617 missense probably benign
IGL02527:Cand1 APN 10 119206807 missense probably damaging 1.00
IGL02675:Cand1 APN 10 119219697 missense probably damaging 0.99
IGL02796:Cand1 UTSW 10 119213638 missense probably damaging 1.00
R0114:Cand1 UTSW 10 119216522 missense probably benign
R0667:Cand1 UTSW 10 119216520 missense probably benign 0.00
R1589:Cand1 UTSW 10 119213566 missense probably damaging 0.97
R1591:Cand1 UTSW 10 119211869 missense possibly damaging 0.63
R1626:Cand1 UTSW 10 119210014 missense possibly damaging 0.46
R1771:Cand1 UTSW 10 119208306 missense probably benign 0.05
R1937:Cand1 UTSW 10 119203020 missense probably damaging 1.00
R1951:Cand1 UTSW 10 119208020 splice site probably benign
R1990:Cand1 UTSW 10 119210067 missense probably damaging 1.00
R3522:Cand1 UTSW 10 119239197 missense probably benign 0.01
R4207:Cand1 UTSW 10 119211845 missense probably damaging 1.00
R4209:Cand1 UTSW 10 119211558 missense probably benign 0.24
R4791:Cand1 UTSW 10 119210702 missense probably benign 0.02
R4841:Cand1 UTSW 10 119213546 critical splice donor site probably null
R4842:Cand1 UTSW 10 119213546 critical splice donor site probably null
R5326:Cand1 UTSW 10 119212028 missense probably benign
R5606:Cand1 UTSW 10 119211454 missense possibly damaging 0.63
R5613:Cand1 UTSW 10 119215323 missense possibly damaging 0.93
R5768:Cand1 UTSW 10 119211005 missense probably benign 0.06
R5884:Cand1 UTSW 10 119213765 missense possibly damaging 0.90
R6006:Cand1 UTSW 10 119210028 missense possibly damaging 0.83
R6062:Cand1 UTSW 10 119218010 missense possibly damaging 0.89
R6734:Cand1 UTSW 10 119211992 missense possibly damaging 0.67
R6838:Cand1 UTSW 10 119210030 missense probably benign 0.21
R7058:Cand1 UTSW 10 119211754 missense probably benign 0.00
R7342:Cand1 UTSW 10 119211787 missense possibly damaging 0.64
R7425:Cand1 UTSW 10 119216243 missense probably benign 0.00
R7705:Cand1 UTSW 10 119212438 critical splice donor site probably null
R7812:Cand1 UTSW 10 119217959 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCAATACACTGTATGTAGGTCC -3'
(R):5'- GGGGAAACACACCTCAGATC -3'

Sequencing Primer
(F):5'- AATACACTGTATGTAGGTCCTTGTTG -3'
(R):5'- ATCCATTTAGCTTAGGATTTTGCAGG -3'
Posted On2015-07-21