Incidental Mutation 'R4539:Camta1'
ID333440
Institutional Source Beutler Lab
Gene Symbol Camta1
Ensembl Gene ENSMUSG00000014592
Gene Namecalmodulin binding transcription activator 1
Synonyms1810059M14Rik, 2310058O09Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.609) question?
Stock #R4539 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location150917322-151861876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151084812 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 161 (I161V)
Ref Sequence ENSEMBL: ENSMUSP00000101295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049790] [ENSMUST00000097774] [ENSMUST00000105667] [ENSMUST00000105668] [ENSMUST00000105670] [ENSMUST00000131948] [ENSMUST00000169423]
Predicted Effect probably benign
Transcript: ENSMUST00000049790
AA Change: I1139V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000054804
Gene: ENSMUSG00000014592
AA Change: I1139V

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3e-13 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097774
AA Change: I1139V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000095381
Gene: ENSMUSG00000014592
AA Change: I1139V

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1570 5.45e1 SMART
IQ 1571 1593 5.42e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105667
Predicted Effect probably benign
Transcript: ENSMUST00000105668
AA Change: I161V

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101293
Gene: ENSMUSG00000014592
AA Change: I161V

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
ANK 88 117 1.7e2 SMART
ANK 133 163 4.73e2 SMART
Blast:ANK 167 197 6e-10 BLAST
IQ 457 473 2.38e2 SMART
IQ 487 509 5.42e0 SMART
Pfam:IQ 512 527 5.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105670
AA Change: I161V

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101295
Gene: ENSMUSG00000014592
AA Change: I161V

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
ANK 88 117 1.7e2 SMART
ANK 133 163 4.73e2 SMART
Blast:ANK 167 197 5e-10 BLAST
IQ 457 479 5.45e1 SMART
IQ 480 502 5.42e0 SMART
Pfam:IQ 505 520 5.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131948
SMART Domains Protein: ENSMUSP00000118969
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143434
Predicted Effect probably benign
Transcript: ENSMUST00000169423
AA Change: I1139V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592
AA Change: I1139V

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Global or nervous system deletion of this gene results in decreased body size, severe ataxia, progressive Purkinje cell degeneration, and cerebellar atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,715,793 T702A probably benign Het
Alms1 C T 6: 85,620,478 T762I possibly damaging Het
Arhgef18 T C 8: 3,447,070 M465T probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cpeb4 G A 11: 31,873,206 G307S probably damaging Het
Eps8l1 T C 7: 4,478,624 V707A probably damaging Het
Espn G A 4: 152,134,208 Q473* probably null Het
Fut9 A T 4: 25,619,793 H340Q probably damaging Het
Gm11554 A T 11: 99,804,360 probably benign Het
Hcar2 A G 5: 123,864,730 F237L probably damaging Het
Hectd4 T A 5: 121,314,907 C492* probably null Het
Lrrk2 C T 15: 91,729,142 P823L possibly damaging Het
Luzp2 A T 7: 55,063,289 Q91L probably damaging Het
Mapkapk5 T A 5: 121,537,155 H117L possibly damaging Het
Myh14 A G 7: 44,627,054 L1209P probably damaging Het
Myo3b T G 2: 70,039,147 M1R probably null Het
Nacad A T 11: 6,600,677 V838E possibly damaging Het
Neurl1a T A 19: 47,256,744 S458T probably damaging Het
Pdzrn4 A G 15: 92,770,589 D874G probably damaging Het
Phykpl A G 11: 51,594,088 T292A probably damaging Het
Piezo2 A G 18: 63,086,628 Y1003H probably damaging Het
Ppih A G 4: 119,320,459 S6P probably benign Het
Qrich1 A G 9: 108,534,200 E308G probably damaging Het
Setx A G 2: 29,179,748 T2522A probably benign Het
Slc26a8 A T 17: 28,659,617 M332K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sphkap A G 1: 83,277,793 V745A probably benign Het
Swi5 T C 2: 32,279,080 N118S possibly damaging Het
Tenm2 T C 11: 36,046,780 T1689A probably damaging Het
Ttll9 C T 2: 152,994,091 R252C probably damaging Het
Vars2 T A 17: 35,666,888 E80V probably damaging Het
Zbtb39 G A 10: 127,742,192 D212N possibly damaging Het
Zfp418 C A 7: 7,181,277 Q80K probably benign Het
Zscan25 A G 5: 145,288,391 D259G probably benign Het
Other mutations in Camta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Camta1 APN 4 151071424 critical splice donor site probably null
IGL00823:Camta1 APN 4 151084601 missense probably benign 0.02
IGL01361:Camta1 APN 4 151144692 missense probably damaging 1.00
IGL01523:Camta1 APN 4 151145050 missense possibly damaging 0.73
IGL01730:Camta1 APN 4 151062845 missense probably damaging 0.99
IGL02045:Camta1 APN 4 151073985 splice site probably null
IGL02541:Camta1 APN 4 151084655 missense probably benign 0.12
IGL02839:Camta1 APN 4 151144512 missense probably damaging 1.00
IGL03012:Camta1 APN 4 151453299 missense probably damaging 1.00
Bonus UTSW 4 151138375 missense probably damaging 1.00
PIT4449001:Camta1 UTSW 4 151131586 missense probably benign 0.00
R0136:Camta1 UTSW 4 151078969 missense probably damaging 0.99
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0276:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0346:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0347:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0348:Camta1 UTSW 4 151586431 missense possibly damaging 0.64
R0385:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0386:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0388:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0410:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0456:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0478:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0510:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0511:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0683:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0724:Camta1 UTSW 4 151077892 missense probably damaging 1.00
R0732:Camta1 UTSW 4 151586484 critical splice acceptor site probably null
R1549:Camta1 UTSW 4 151586463 missense probably damaging 1.00
R1670:Camta1 UTSW 4 151079771 missense probably benign 0.00
R1704:Camta1 UTSW 4 151075224 missense probably damaging 1.00
R1718:Camta1 UTSW 4 151084024 missense probably benign 0.00
R1941:Camta1 UTSW 4 151075155 missense probably damaging 1.00
R1967:Camta1 UTSW 4 151088973 missense probably damaging 0.99
R1998:Camta1 UTSW 4 151077880 missense probably damaging 1.00
R2081:Camta1 UTSW 4 151144242 missense probably benign 0.24
R2104:Camta1 UTSW 4 151453294 missense probably damaging 0.99
R2240:Camta1 UTSW 4 151084575 missense possibly damaging 0.66
R4516:Camta1 UTSW 4 151144720 missense possibly damaging 0.90
R4552:Camta1 UTSW 4 151792502 missense probably damaging 0.96
R4610:Camta1 UTSW 4 151084827 missense probably damaging 1.00
R4658:Camta1 UTSW 4 151143910 missense probably damaging 1.00
R4725:Camta1 UTSW 4 151148496 missense probably benign 0.11
R4786:Camta1 UTSW 4 151290039 missense probably damaging 1.00
R4812:Camta1 UTSW 4 151131542 missense probably null 0.25
R4840:Camta1 UTSW 4 151144407 missense probably benign 0.23
R5038:Camta1 UTSW 4 151145469 missense probably damaging 1.00
R5112:Camta1 UTSW 4 151074054 missense probably damaging 1.00
R5251:Camta1 UTSW 4 151163884 missense probably damaging 1.00
R5388:Camta1 UTSW 4 151075238 missense probably damaging 1.00
R5487:Camta1 UTSW 4 151144754 missense possibly damaging 0.73
R6343:Camta1 UTSW 4 151079849 missense probably damaging 0.98
R6462:Camta1 UTSW 4 151086164 missense probably damaging 0.98
R6550:Camta1 UTSW 4 151138375 missense probably damaging 1.00
R6990:Camta1 UTSW 4 151145044 missense probably damaging 0.97
R7165:Camta1 UTSW 4 151084700 missense possibly damaging 0.63
R7190:Camta1 UTSW 4 151148523 missense possibly damaging 0.57
R7215:Camta1 UTSW 4 151144737 missense probably damaging 1.00
R7264:Camta1 UTSW 4 151453399 missense probably damaging 1.00
R7403:Camta1 UTSW 4 151453295 nonsense probably null
R7445:Camta1 UTSW 4 151144291 missense possibly damaging 0.94
R7447:Camta1 UTSW 4 151083870 missense probably benign 0.31
R7585:Camta1 UTSW 4 151144830 missense probably damaging 1.00
R7881:Camta1 UTSW 4 151835876 missense probably damaging 0.99
R7964:Camta1 UTSW 4 151835876 missense probably damaging 0.99
R8057:Camta1 UTSW 4 151144032 missense probably damaging 1.00
R8073:Camta1 UTSW 4 151078824 missense probably damaging 1.00
X0063:Camta1 UTSW 4 151145247 missense probably damaging 1.00
Z1176:Camta1 UTSW 4 151144385 missense probably benign 0.06
Z1177:Camta1 UTSW 4 151077925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCAGCTGTCTGTGGTTG -3'
(R):5'- ATGCACACCATTATTTCTCGTTGG -3'

Sequencing Primer
(F):5'- GGCTCTTCGCTTGGGGC -3'
(R):5'- CTCGTTGGAATCAGATAGCTGTAATG -3'
Posted On2015-08-18