Incidental Mutation 'R0208:Idua'
ID33464
Institutional Source Beutler Lab
Gene Symbol Idua
Ensembl Gene ENSMUSG00000033540
Gene Nameiduronidase, alpha-L-
Synonyms
MMRRC Submission 038461-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R0208 (G1)
Quality Score85
Status Not validated
Chromosome5
Chromosomal Location108660331-108684557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108681752 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 447 (F447I)
Ref Sequence ENSEMBL: ENSMUSP00000113190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071650] [ENSMUST00000112563] [ENSMUST00000119212] [ENSMUST00000139734] [ENSMUST00000140620]
Predicted Effect probably damaging
Transcript: ENSMUST00000071650
AA Change: F494I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540
AA Change: F494I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112563
AA Change: F494I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108182
Gene: ENSMUSG00000033540
AA Change: F494I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 2.1e-224 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119212
AA Change: F447I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113190
Gene: ENSMUSG00000033540
AA Change: F447I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Glyco_hydro_39 48 495 2.4e-193 PFAM
SCOP:d1bpv__ 499 596 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133482
Predicted Effect probably benign
Transcript: ENSMUST00000139734
SMART Domains Protein: ENSMUSP00000117694
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 199 6.8e-80 PFAM
low complexity region 235 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140620
SMART Domains Protein: ENSMUSP00000119624
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 150 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159464
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutants show lysosomal storage in multiple tissues, increased urinary GAG, craniofacial and skeletal defects, increased body weight, impaired habituation and long-term memory for aversive training, reduced ventricular function with valve insufficiency, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,661 V29A probably benign Het
Adgrb1 T C 15: 74,586,807 F313L probably benign Het
Arfgef2 C T 2: 166,867,422 R1140W probably damaging Het
Arhgef15 A T 11: 68,946,373 N797K probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Asb2 T A 12: 103,325,271 N466Y possibly damaging Het
Atp8a1 A T 5: 67,774,721 probably null Het
C130079G13Rik C T 3: 59,932,689 R61C probably damaging Het
Cacna1b A G 2: 24,607,480 S2140P probably damaging Het
Camsap2 G C 1: 136,281,000 P918R probably damaging Het
Cdk7 G T 13: 100,706,514 D202E probably benign Het
Cenpj G T 14: 56,563,970 A182E probably benign Het
Clstn3 A G 6: 124,432,169 probably benign Het
Col9a2 C T 4: 121,052,288 probably benign Het
D630045J12Rik A G 6: 38,139,450 M1745T probably damaging Het
Dnah11 A C 12: 118,043,774 N2156K probably damaging Het
Dock3 G T 9: 106,996,996 Y425* probably null Het
Eng A T 2: 32,678,993 T511S probably benign Het
Gcfc2 A T 6: 81,943,463 S410C probably null Het
Grik3 T A 4: 125,686,165 Y568N probably damaging Het
Gsr T A 8: 33,689,355 D330E possibly damaging Het
H2-M10.4 A G 17: 36,460,483 W268R probably damaging Het
Hepacam2 A T 6: 3,467,505 probably benign Het
Hrct1 C A 4: 43,727,384 T8K possibly damaging Het
Il2ra T C 2: 11,682,017 probably benign Het
Ipcef1 A G 10: 6,920,062 S113P probably damaging Het
Klk1b9 T A 7: 43,979,430 N119K possibly damaging Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Loxhd1 T A 18: 77,404,866 F1334L possibly damaging Het
Med1 A G 11: 98,155,689 probably benign Het
Med13 A G 11: 86,300,856 probably benign Het
Mtor C A 4: 148,464,975 H605Q probably benign Het
Muc19 A G 15: 91,893,024 noncoding transcript Het
Mybphl T C 3: 108,375,415 V207A probably damaging Het
Nptxr A T 15: 79,789,715 C366S probably null Het
Olfr1099 G T 2: 86,959,404 T18K probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr498 A G 7: 108,465,543 D73G probably damaging Het
Pcdhb18 T C 18: 37,490,187 I190T possibly damaging Het
Pde3b A G 7: 114,497,981 T428A probably benign Het
Pgbd1 A C 13: 21,434,481 L2R probably damaging Het
Pkp4 A G 2: 59,266,436 I61V probably damaging Het
Pold4 T G 19: 4,232,539 Y58* probably null Het
Polr1d A C 5: 147,078,680 probably null Het
Prex2 T A 1: 11,285,144 D1556E probably damaging Het
Psmd1 T C 1: 86,133,741 V891A possibly damaging Het
Rasip1 C A 7: 45,632,575 P501T probably damaging Het
Scgb2b27 C A 7: 34,012,137 E96* probably null Het
Sec16b G T 1: 157,552,935 G359* probably null Het
Secisbp2 A G 13: 51,679,845 T674A probably benign Het
Serpinb6c G A 13: 33,897,396 S90L probably benign Het
Sgsm2 A G 11: 74,868,241 I170T probably damaging Het
Slc28a1 A T 7: 81,117,706 probably benign Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spg11 C T 2: 122,055,696 probably null Het
Spint1 T C 2: 119,248,345 probably benign Het
Spta1 A G 1: 174,192,960 H545R probably damaging Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tln1 C T 4: 43,549,151 V644M probably damaging Het
Unc79 G A 12: 103,092,027 V1016I probably benign Het
Usf3 C A 16: 44,216,906 A583E probably damaging Het
Ush2a A C 1: 188,531,761 I1612L probably damaging Het
Vmn2r6 T C 3: 64,539,912 T578A probably benign Het
Zmat4 T A 8: 23,902,067 M13K probably damaging Het
Other mutations in Idua
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Idua APN 5 108680871 missense probably benign 0.34
IGL01575:Idua APN 5 108682107 missense possibly damaging 0.71
IGL02402:Idua APN 5 108679791 missense probably damaging 1.00
IGL03145:Idua APN 5 108681496 missense probably benign
cooper UTSW 5 108680314 missense probably damaging 1.00
R1572:Idua UTSW 5 108680589 missense probably benign
R1731:Idua UTSW 5 108681672 missense probably benign 0.00
R2024:Idua UTSW 5 108680734 missense probably damaging 1.00
R2126:Idua UTSW 5 108681438 missense possibly damaging 0.93
R3760:Idua UTSW 5 108670112 unclassified probably benign
R4747:Idua UTSW 5 108681036 missense probably damaging 0.97
R4832:Idua UTSW 5 108669381 missense probably benign
R5140:Idua UTSW 5 108680314 missense probably damaging 1.00
R5543:Idua UTSW 5 108670229 missense probably benign 0.22
R5643:Idua UTSW 5 108680224 utr 3 prime probably benign
R5821:Idua UTSW 5 108679734 missense probably benign 0.29
R6004:Idua UTSW 5 108680644 missense probably benign
R6330:Idua UTSW 5 108681708 missense probably benign 0.21
R6963:Idua UTSW 5 108679775 missense possibly damaging 0.84
R7180:Idua UTSW 5 108680895 missense probably benign 0.43
R7453:Idua UTSW 5 108681496 missense probably benign
R7575:Idua UTSW 5 108681699 missense probably damaging 1.00
R7712:Idua UTSW 5 108681522 missense probably benign 0.10
R8026:Idua UTSW 5 108670249 missense probably benign 0.01
R8029:Idua UTSW 5 108669412 missense probably benign 0.23
R8074:Idua UTSW 5 108680575 missense possibly damaging 0.65
Z1177:Idua UTSW 5 108679584 missense probably null 0.80
Z1177:Idua UTSW 5 108680623 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTTGGACAGCAATCATACAGTGGG -3'
(R):5'- TGCATACATGCACCAGCAGGAG -3'

Sequencing Primer
(F):5'- TGGAGTACCACAGTCCTCATC -3'
(R):5'- TGCACCAGCAGGAGTGATG -3'
Posted On2013-05-09