Incidental Mutation 'R0208:Tln1'

• ID: 33457
• Institutional Source: Beutler Lab
• Gene Symbol: Tln1
• Ensembl Gene: ENSMUSG00000028465
• Gene Name: talin 1
• MMRRC Submission: 038461-MU
• Essential gene?: Essential (E-score: 1.000)
• Stock #: R0208 (G1)
• Quality Score: 225
• Status: Validated
• Chromosome: 4
• Chromosomal Location: 43531519-43562691 bp(-) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): C to T at 43549151 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Valine to Methionine at position 644 (V644M)
• Ref Sequence: ENSEMBL: ENSMUSP00000030187
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000030187]
• AlphaFold: P26039
• PDB Structure: Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION] ; Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION] ; Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION] ; Solution structure of VBS2 fragment of talin [SOLUTION NMR] ; Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION] ; Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION] ; Solution structure of VBS3 fragment of talin [SOLUTION NMR] ; NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR] ; NMR structure of the talin C-terminal actin binding site [SOLUTION NMR] ; NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR] ; >> 16 additional structures at PDB <<
• Predicted Effect: probably damaging; Transcript: ENSMUST00000030187; AA Change: V644M; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
• SMART Domains: Protein: ENSMUSP00000030187; Gene: ENSMUSG00000028465; AA Change: V644M

Domain	Start	End	E-Value	Type
Blast:B41	2	76	5e-31	BLAST
B41	82	313	4.66e-73	SMART
IRS	308	401	7.65e-16	SMART
Pfam:Talin_middle	491	652	8.2e-60	PFAM
low complexity region	671	690	N/A	INTRINSIC
internal_repeat_2	699	760	8.94e-6	PROSPERO
low complexity region	766	775	N/A	INTRINSIC
PDB:1ZVZ|B	820	844	2e-7	PDB
low complexity region	866	879	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
PDB:2LQG|A	913	1044	2e-44	PDB
PDB:2L7N|A	1046	1207	1e-101	PDB
Pfam:VBS	1234	1358	9.6e-8	PFAM
internal_repeat_2	1488	1549	8.94e-6	PROSPERO
internal_repeat_3	1623	1769	4.92e-5	PROSPERO
low complexity region	1817	1828	N/A	INTRINSIC
Pfam:VBS	1849	1973	6.2e-67	PFAM
PDB:3DYJ|B	1974	2293	N/A	PDB
low complexity region	2305	2327	N/A	INTRINSIC
ILWEQ	2336	2533	2.93e-105	SMART

• Predicted Effect: unknown; Transcript: ENSMUST00000125509; AA Change: V184M
• SMART Domains: Protein: ENSMUSP00000115681; Gene: ENSMUSG00000028465; AA Change: V184M

Domain	Start	End	E-Value	Type
Blast:IRS	2	28	2e-9	BLAST
PDB:2G35|A	2	29	3e-11	PDB
Pfam:Talin_middle	32	193	1.8e-61	PFAM
PDB:2L7A|A	215	279	1e-38	PDB

• Predicted Effect: noncoding transcript; Transcript: ENSMUST00000127262
• Predicted Effect: probably benign; Transcript: ENSMUST00000134623
• SMART Domains: Protein: ENSMUSP00000119956; Gene: ENSMUSG00000028465

Domain	Start	End	E-Value	Type
PDB:1U89|A	2	106	9e-50	PDB
low complexity region	107	120	N/A	INTRINSIC

• Meta Mutation Damage Score: 0.4779
• Coding Region Coverage:
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
• Validation Efficiency: 96% (67/70)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009] ; PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
• Posted On: 2013-05-09

Predicted Primers

PCR Primer
(F):5'- CAGGGCTAAGAACATCATCAAGGGC -3'
(R):5'- AACTGCAATGGTACTTCCTCCCCG -3'

Sequencing Primer
(F):5'- CATGGGACTAGAAGTTCTCAGTATC -3'
(R):5'- TCTTCCAACCTGACGGAGATG -3'