Incidental Mutation 'R4674:Tia1'
ID348694
Institutional Source Beutler Lab
Gene Symbol Tia1
Ensembl Gene ENSMUSG00000071337
Gene Namecytotoxic granule-associated RNA binding protein 1
Synonyms2310050N03Rik, mTIA-1
MMRRC Submission 041929-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R4674 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86404219-86433405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86420400 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 118 (F118L)
Ref Sequence ENSEMBL: ENSMUSP00000118558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095752] [ENSMUST00000095753] [ENSMUST00000095754] [ENSMUST00000113712] [ENSMUST00000113713] [ENSMUST00000130967] [ENSMUST00000148728] [ENSMUST00000154438]
Predicted Effect probably damaging
Transcript: ENSMUST00000095752
AA Change: F118L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093424
Gene: ENSMUSG00000071337
AA Change: F118L

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 271 2.25e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095753
AA Change: F129L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093425
Gene: ENSMUSG00000071337
AA Change: F129L

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095754
AA Change: F129L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093426
Gene: ENSMUSG00000071337
AA Change: F129L

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113708
SMART Domains Protein: ENSMUSP00000109338
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113712
AA Change: F129L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138652
Gene: ENSMUSG00000071337
AA Change: F129L

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113713
AA Change: F120L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109342
Gene: ENSMUSG00000071337
AA Change: F120L

DomainStartEndE-ValueType
RRM 8 81 1.62e-23 SMART
RRM 98 171 5.15e-26 SMART
RRM 206 273 2.25e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126404
Predicted Effect probably damaging
Transcript: ENSMUST00000130967
AA Change: F118L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118558
Gene: ENSMUSG00000071337
AA Change: F118L

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 258 1.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147104
Predicted Effect possibly damaging
Transcript: ENSMUST00000148728
AA Change: F118L

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144857
Gene: ENSMUSG00000071337
AA Change: F118L

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Pfam:RRM_1 97 131 1.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152852
Predicted Effect probably benign
Transcript: ENSMUST00000154438
SMART Domains Protein: ENSMUSP00000145218
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205109
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced postnatal survival and functional abnormalities in the immune system with no gross abnormalities in any of the major organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,810,615 I112T probably benign Het
Acvr1b T C 15: 101,203,058 I367T possibly damaging Het
Akr1b8 G A 6: 34,356,424 probably null Het
Ash1l T C 3: 89,072,476 V2769A possibly damaging Het
Asxl3 A T 18: 22,517,738 D928V probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Ccdc82 A T 9: 13,252,635 H184L probably benign Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Clec1b C A 6: 129,400,134 L47I probably damaging Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Crbn T A 6: 106,790,971 Q173L possibly damaging Het
Cspg4 T C 9: 56,898,205 V2100A probably damaging Het
Cyp46a1 T C 12: 108,358,086 L374P probably damaging Het
Dhx16 T A 17: 35,885,939 V607E probably damaging Het
Dido1 A G 2: 180,687,559 S357P probably damaging Het
Dnah6 T A 6: 73,192,422 I399F probably benign Het
Dock10 T C 1: 80,606,620 E123G possibly damaging Het
Dstyk A G 1: 132,463,390 D843G probably benign Het
Efcab12 C A 6: 115,823,649 V138F probably damaging Het
Egf A G 3: 129,718,040 F493L probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
Exoc6 T C 19: 37,609,082 F644L probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fam184b T A 5: 45,582,888 K319* probably null Het
Fam208b T C 13: 3,573,686 E1406G possibly damaging Het
Flrt2 T A 12: 95,780,688 L600* probably null Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gli2 T C 1: 118,836,029 E1464G probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
H2afy A C 13: 56,083,184 C297G possibly damaging Het
Hdac9 A G 12: 34,373,960 V501A possibly damaging Het
Heca T C 10: 17,915,309 H333R probably benign Het
Hirip3 G A 7: 126,864,662 probably null Het
Igsf8 G A 1: 172,318,912 W51* probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Krt73 T C 15: 101,802,075 N75D probably benign Het
Macf1 T A 4: 123,472,397 Y1292F probably benign Het
Mapk14 A G 17: 28,745,022 probably null Het
Mgat5 T A 1: 127,390,758 V330D probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,444,174 F188L probably damaging Het
Ncoa3 T C 2: 166,059,811 S1035P probably benign Het
Ndn T A 7: 62,348,822 W139R probably damaging Het
Nes T C 3: 87,971,795 V198A possibly damaging Het
Olfr1212 G T 2: 88,958,872 M135I probably damaging Het
Olfr1260 A G 2: 89,977,906 I43V possibly damaging Het
Olfr1465 T A 19: 13,313,814 H157L probably benign Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Pcf11 G A 7: 92,659,777 probably benign Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Pipox T G 11: 77,893,770 Q4P probably benign Het
Pla2g4c C T 7: 13,343,514 T327I probably null Het
Plppr1 C T 4: 49,323,384 R225W probably damaging Het
Pnpla6 T A 8: 3,521,412 V145D probably damaging Het
Pnpla7 T C 2: 25,052,317 Y83H probably damaging Het
Rif1 T A 2: 52,106,942 L970Q probably null Het
Rimklb C A 6: 122,456,283 E303* probably null Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rttn T A 18: 89,011,011 probably null Het
Sf3b3 G A 8: 110,844,505 R10W probably damaging Het
Skint4 G A 4: 112,118,233 C130Y probably damaging Het
Snap91 A G 9: 86,792,017 S593P possibly damaging Het
Ssb A G 2: 69,868,850 Q209R probably benign Het
Stap1 A T 5: 86,081,185 I71L probably benign Het
Syna C A 5: 134,558,355 R580L probably damaging Het
Tacc2 T A 7: 130,624,861 M1111K possibly damaging Het
Tanc2 T C 11: 105,867,480 L689P probably damaging Het
Tdrd5 A C 1: 156,277,435 C463W probably damaging Het
Tet1 A G 10: 62,838,848 F1150L probably damaging Het
Trav3-1 A T 14: 52,581,003 T45S possibly damaging Het
Uaca A T 9: 60,854,429 Y235F possibly damaging Het
Ube4b T C 4: 149,331,370 N44S possibly damaging Het
Vmn2r93 T A 17: 18,304,993 H304Q probably benign Het
Wdr18 A G 10: 79,965,235 I161V probably benign Het
Zfp112 A G 7: 24,126,974 H789R probably damaging Het
Zfp873 A G 10: 82,059,980 T182A possibly damaging Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Zufsp A T 10: 33,948,984 D167E possibly damaging Het
Other mutations in Tia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02643:Tia1 APN 6 86416390 missense probably benign 0.16
R0322:Tia1 UTSW 6 86420387 missense probably damaging 1.00
R1118:Tia1 UTSW 6 86419109 missense probably benign 0.00
R1451:Tia1 UTSW 6 86430339 missense probably benign 0.00
R1631:Tia1 UTSW 6 86420348 missense probably damaging 1.00
R2275:Tia1 UTSW 6 86427677 missense probably benign 0.00
R2509:Tia1 UTSW 6 86424330 splice site probably null
R3952:Tia1 UTSW 6 86416337 missense probably damaging 1.00
R4596:Tia1 UTSW 6 86420407 missense probably benign 0.34
R4919:Tia1 UTSW 6 86424323 unclassified probably benign
R6339:Tia1 UTSW 6 86426656 missense probably damaging 1.00
R6455:Tia1 UTSW 6 86420378 missense probably damaging 1.00
R7139:Tia1 UTSW 6 86427688 missense possibly damaging 0.95
R7804:Tia1 UTSW 6 86424382 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTTCTGGTAGCTATCAGTCC -3'
(R):5'- GTACTTGCTTTCAGACTCTTGGATG -3'

Sequencing Primer
(F):5'- GGTAGCTATCAGTCCTTTTAGAAGAC -3'
(R):5'- TCAGACTCTTGGATGATCTCTAAAC -3'
Posted On2015-10-08