Incidental Mutation 'R7804:Tia1'
ID600664
Institutional Source Beutler Lab
Gene Symbol Tia1
Ensembl Gene ENSMUSG00000071337
Gene Namecytotoxic granule-associated RNA binding protein 1
Synonyms2310050N03Rik, mTIA-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R7804 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location86404219-86433405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86424382 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 146 (S146P)
Ref Sequence ENSEMBL: ENSMUSP00000093425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095752] [ENSMUST00000095753] [ENSMUST00000095754] [ENSMUST00000113712] [ENSMUST00000113713] [ENSMUST00000123267] [ENSMUST00000130967] [ENSMUST00000148728] [ENSMUST00000154438] [ENSMUST00000204137]
PDB Structure Solution structure of the second RNA recognition motif (RRM) of TIA-1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000095752
AA Change: S135P

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093424
Gene: ENSMUSG00000071337
AA Change: S135P

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 271 2.25e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095753
AA Change: S146P

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000093425
Gene: ENSMUSG00000071337
AA Change: S146P

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095754
AA Change: S146P

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093426
Gene: ENSMUSG00000071337
AA Change: S146P

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113712
AA Change: S146P

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138652
Gene: ENSMUSG00000071337
AA Change: S146P

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113713
AA Change: S137P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000109342
Gene: ENSMUSG00000071337
AA Change: S137P

DomainStartEndE-ValueType
RRM 8 81 1.62e-23 SMART
RRM 98 171 5.15e-26 SMART
RRM 206 273 2.25e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123267
SMART Domains Protein: ENSMUSP00000145407
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 12 79 1e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130967
AA Change: S135P

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118558
Gene: ENSMUSG00000071337
AA Change: S135P

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 258 1.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148728
SMART Domains Protein: ENSMUSP00000144857
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Pfam:RRM_1 97 131 1.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154438
SMART Domains Protein: ENSMUSP00000145218
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204137
Meta Mutation Damage Score 0.4784 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced postnatal survival and functional abnormalities in the immune system with no gross abnormalities in any of the major organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTATGTGT GTGTGT 11: 43,587,414 probably benign Het
Ago4 A T 4: 126,512,630 C296S probably benign Het
Apbb1 A G 7: 105,566,600 L401P probably damaging Het
Cacnb2 C A 2: 14,968,037 P252T probably benign Het
Ctnna2 C T 6: 77,641,374 V202I probably benign Het
Dapk1 A T 13: 60,725,339 I352F probably benign Het
Dexi T C 16: 10,542,485 D69G possibly damaging Het
Dgcr14 T A 16: 17,911,167 I47F probably damaging Het
Dlg5 T C 14: 24,165,320 E645G possibly damaging Het
Dnah3 A G 7: 119,952,618 I2826T probably damaging Het
Dnah3 A G 7: 120,011,012 W1734R probably damaging Het
Dtna A G 18: 23,595,609 K287R probably damaging Het
Elovl5 A G 9: 77,979,823 probably null Het
Fam222b C A 11: 78,154,153 P180Q probably benign Het
Fat3 C T 9: 15,990,592 V3046I probably benign Het
Fem1a A G 17: 56,258,068 D387G probably damaging Het
Frmd5 A G 2: 121,591,744 Y33H probably damaging Het
Gucy2g A T 19: 55,228,152 L464H probably benign Het
Ints2 T C 11: 86,212,663 E1189G possibly damaging Het
Itgb4 T C 11: 116,003,684 V1355A probably damaging Het
Lepr A T 4: 101,782,586 S750C probably damaging Het
Lingo1 T C 9: 56,619,514 D603G probably benign Het
Map4k3 A C 17: 80,615,070 V474G probably damaging Het
Myl4 T A 11: 104,584,961 V167E probably damaging Het
Naa25 T C 5: 121,424,589 V478A probably benign Het
Neurl4 T A 11: 69,905,874 L487H probably benign Het
Nkx2-9 C T 12: 56,612,132 R99H probably damaging Het
Olfr1215 C G 2: 89,001,511 R259P unknown Het
Olfr686 A T 7: 105,204,160 M61K probably damaging Het
Olfr809 A G 10: 129,776,222 I103V probably benign Het
Pcdhga9 A G 18: 37,738,079 I320M probably damaging Het
Pi15 T A 1: 17,624,913 C251* probably null Het
Pkhd1l1 A T 15: 44,597,138 K4248* probably null Het
Prkg1 C T 19: 30,578,632 V625I probably benign Het
Prkg1 G A 19: 30,624,770 A362V possibly damaging Het
Prol1 C T 5: 88,328,405 T218I unknown Het
Ptpro G A 6: 137,399,601 probably null Het
Rev3l T A 10: 39,823,485 I1326K probably benign Het
Shank1 C A 7: 44,312,884 R60S unknown Het
Slc24a2 A G 4: 86,991,537 V648A probably damaging Het
Slc35d3 T C 10: 19,849,370 T247A probably damaging Het
Specc1 C T 11: 62,205,397 T895I probably damaging Het
Spta1 A G 1: 174,195,905 E626G possibly damaging Het
Syngr2 C A 11: 117,812,575 S72R possibly damaging Het
Synj2 T A 17: 6,019,534 L490Q unknown Het
Tbc1d9 T C 8: 83,236,712 L351P possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Themis3 G A 17: 66,555,610 T451I probably benign Het
Tpp2 T A 1: 43,983,281 N946K probably benign Het
Tpr A T 1: 150,432,559 R1688S probably damaging Het
Trav12-1 A G 14: 53,538,531 Q47R possibly damaging Het
Ttll9 G A 2: 153,002,358 probably null Het
Ttn G A 2: 76,707,241 T34781M possibly damaging Het
V1ra8 A G 6: 90,203,316 Y167C probably damaging Het
Vegfb T C 19: 6,986,339 D84G probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wdr26 A G 1: 181,182,822 I554T probably damaging Het
Other mutations in Tia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02643:Tia1 APN 6 86416390 missense probably benign 0.16
R0322:Tia1 UTSW 6 86420387 missense probably damaging 1.00
R1118:Tia1 UTSW 6 86419109 missense probably benign 0.00
R1451:Tia1 UTSW 6 86430339 missense probably benign 0.00
R1631:Tia1 UTSW 6 86420348 missense probably damaging 1.00
R2275:Tia1 UTSW 6 86427677 missense probably benign 0.00
R2509:Tia1 UTSW 6 86424330 splice site probably null
R3952:Tia1 UTSW 6 86416337 missense probably damaging 1.00
R4596:Tia1 UTSW 6 86420407 missense probably benign 0.34
R4674:Tia1 UTSW 6 86420400 missense probably damaging 0.99
R4919:Tia1 UTSW 6 86424323 unclassified probably benign
R6339:Tia1 UTSW 6 86426656 missense probably damaging 1.00
R6455:Tia1 UTSW 6 86420378 missense probably damaging 1.00
R7139:Tia1 UTSW 6 86427688 missense possibly damaging 0.95
R7879:Tia1 UTSW 6 86424365 missense probably damaging 0.97
R8018:Tia1 UTSW 6 86425052 missense probably benign 0.06
R8153:Tia1 UTSW 6 86420332 missense probably damaging 0.99
R8172:Tia1 UTSW 6 86427700 missense probably benign 0.38
R8268:Tia1 UTSW 6 86428014 intron probably benign
R8275:Tia1 UTSW 6 86427736 nonsense probably null
R8409:Tia1 UTSW 6 86425470 missense possibly damaging 0.87
R8430:Tia1 UTSW 6 86418924 missense probably benign 0.30
R8550:Tia1 UTSW 6 86425702 missense probably benign 0.01
R8678:Tia1 UTSW 6 86425703 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAACATCTGCTTTCACCATGC -3'
(R):5'- GGTGCTAAATGACTAAAGAACCAAC -3'

Sequencing Primer
(F):5'- CTGCTTTCACCATGCTTAATATTGAG -3'
(R):5'- CCAGAATAGAACAGGCTGTTTTC -3'
Posted On2019-11-26