Incidental Mutation 'R4626:Snx10'
ID348776
Institutional Source Beutler Lab
Gene Symbol Snx10
Ensembl Gene ENSMUSG00000038301
Gene Namesorting nexin 10
Synonyms
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4626 (G1)
Quality Score178
Status Not validated
Chromosome6
Chromosomal Location51523901-51590679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51588290 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 129 (D129G)
Ref Sequence ENSEMBL: ENSMUSP00000136974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049152] [ENSMUST00000114439] [ENSMUST00000137212] [ENSMUST00000149024] [ENSMUST00000179365]
Predicted Effect probably damaging
Transcript: ENSMUST00000049152
AA Change: D129G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044165
Gene: ENSMUSG00000038301
AA Change: D129G

DomainStartEndE-ValueType
PX 8 124 7.99e-16 SMART
low complexity region 172 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114439
AA Change: D129G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110082
Gene: ENSMUSG00000038301
AA Change: D129G

DomainStartEndE-ValueType
PX 8 124 7.99e-16 SMART
low complexity region 172 191 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000137212
AA Change: D129G

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117914
Gene: ENSMUSG00000038301
AA Change: D129G

DomainStartEndE-ValueType
PX 8 124 7.99e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149024
Predicted Effect probably damaging
Transcript: ENSMUST00000179365
AA Change: D129G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136974
Gene: ENSMUSG00000038301
AA Change: D129G

DomainStartEndE-ValueType
PX 8 124 7.99e-16 SMART
low complexity region 172 191 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. This gene may play a role in regulating endosome homeostasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele show postnatal growth retardation, failure of tooth eruption, impaired skeleton development, and osteopetrorickets associated with failed osteoclast activity, high stomach pH, low calcium availability, impaired bone mineralization, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Snx10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Snx10 APN 6 51588349 missense probably damaging 1.00
IGL03099:Snx10 APN 6 51579860 missense possibly damaging 0.65
BB002:Snx10 UTSW 6 51580321 missense probably benign 0.03
BB012:Snx10 UTSW 6 51580321 missense probably benign 0.03
R1867:Snx10 UTSW 6 51575910 missense probably damaging 1.00
R2100:Snx10 UTSW 6 51588415 missense probably damaging 0.99
R4688:Snx10 UTSW 6 51579938 missense probably damaging 1.00
R5386:Snx10 UTSW 6 51575972 missense probably damaging 1.00
R7925:Snx10 UTSW 6 51580321 missense probably benign 0.03
R8156:Snx10 UTSW 6 51562019 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TAACATGTGATTTCATGCCGTTAGC -3'
(R):5'- TGCCTGCTAAATCAGAGCG -3'

Sequencing Primer
(F):5'- TCGGGGCGAAGTTCCCTAAAG -3'
(R):5'- TGCCTGCTAAATCAGAGCGAAAAG -3'
Posted On2015-10-08