Incidental Mutation 'R4661:Ncln'
ID352872
Institutional Source Beutler Lab
Gene Symbol Ncln
Ensembl Gene ENSMUSG00000020238
Gene Namenicalin
Synonyms
MMRRC Submission 041600-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R4661 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location81486249-81496392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81493068 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 172 (A172V)
Ref Sequence ENSEMBL: ENSMUSP00000020463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020463] [ENSMUST00000053646] [ENSMUST00000118498] [ENSMUST00000124437]
Predicted Effect probably damaging
Transcript: ENSMUST00000020463
AA Change: A172V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020463
Gene: ENSMUSG00000020238
AA Change: A172V

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
Pfam:Peptidase_M28 205 421 1.8e-13 PFAM
Pfam:Nicastrin 217 411 2.1e-9 PFAM
transmembrane domain 521 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053646
SMART Domains Protein: ENSMUSP00000050412
Gene: ENSMUSG00000044199

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
Pfam:7tm_1 66 309 1.2e-32 PFAM
low complexity region 324 337 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118498
AA Change: A172V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112744
Gene: ENSMUSG00000020238
AA Change: A172V

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
Pfam:Peptidase_M28 217 395 3.9e-12 PFAM
Pfam:Nicastrin 217 411 1.5e-10 PFAM
transmembrane domain 520 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124437
SMART Domains Protein: ENSMUSP00000115235
Gene: ENSMUSG00000020238

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153205
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,287,330 N42D probably damaging Het
Adamdec1 G A 14: 68,570,113 T366I probably damaging Het
Adamts7 C A 9: 90,193,330 H1038Q probably benign Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Amhr2 A T 15: 102,454,253 D485V probably damaging Het
Arhgap35 A T 7: 16,564,738 F134Y probably damaging Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a A G 2: 168,637,672 F928L possibly damaging Het
BC034090 A T 1: 155,232,475 D13E probably damaging Het
Bco1 A G 8: 117,129,241 E425G probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
C1s1 T C 6: 124,536,490 I193V probably benign Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Catsperz T G 19: 6,924,803 T108P probably benign Het
Cep57l1 T A 10: 41,719,771 D329V possibly damaging Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chrna2 G A 14: 66,148,843 G146D probably damaging Het
Col6a1 A C 10: 76,714,672 F520V unknown Het
Cyb5d2 C A 11: 72,778,945 V43L probably damaging Het
Cyp2c40 T C 19: 39,786,846 T321A probably benign Het
Dnajc16 A C 4: 141,763,548 Y764D probably damaging Het
Dsg1a G A 18: 20,340,533 V888M probably damaging Het
F5 A C 1: 164,184,920 T468P probably damaging Het
Faap24 A G 7: 35,395,084 M97T probably benign Het
Fam227b A T 2: 126,007,310 I334N probably damaging Het
Frem2 G T 3: 53,655,443 P548T probably damaging Het
Gfm1 A G 3: 67,433,398 E94G probably damaging Het
Gm17606 A T 14: 54,648,239 probably benign Het
Gnb2 A T 5: 137,530,253 M1K probably null Het
Gys1 G A 7: 45,454,834 A544T probably damaging Het
Hdac5 T C 11: 102,205,849 Y230C probably damaging Het
Hunk A T 16: 90,447,308 probably null Het
Ifnl2 A G 7: 28,510,210 F51L probably damaging Het
Itpr1 T C 6: 108,410,931 probably null Het
Kcnj1 A G 9: 32,396,622 Y114C probably benign Het
Kdm4b T A 17: 56,399,459 S322T probably damaging Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Kif6 T C 17: 49,753,881 V414A probably benign Het
L1td1 A G 4: 98,733,624 K141R possibly damaging Het
Loxhd1 A G 18: 77,402,885 I1394V possibly damaging Het
Lrfn5 A T 12: 61,839,647 M74L probably damaging Het
Lrp6 C T 6: 134,511,267 D289N probably benign Het
Mroh7 A G 4: 106,691,513 probably null Het
Muc4 A C 16: 32,769,277 E2885A possibly damaging Het
Myo18b G T 5: 112,875,175 probably benign Het
Nek9 G A 12: 85,320,892 T335M possibly damaging Het
Notch2 A G 3: 98,135,513 Y1398C probably damaging Het
Olfr472 A T 7: 107,902,981 H88L probably benign Het
Olfr710 T A 7: 106,944,867 I45F probably damaging Het
Olfr981 A T 9: 40,022,527 I45F probably damaging Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pde6c A G 19: 38,169,439 Y637C probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Pold1 G T 7: 44,532,809 P1100T probably damaging Het
Prune2 T C 19: 17,000,023 Y41H probably damaging Het
Rgl2 C T 17: 33,933,226 A329V possibly damaging Het
Rilp T A 11: 75,511,424 Y250N probably damaging Het
Rilpl1 A G 5: 124,514,688 V19A probably benign Het
Rtp3 T C 9: 110,986,451 probably null Het
Rufy4 A G 1: 74,133,107 K246E probably damaging Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Slc26a8 A T 17: 28,638,684 N828K probably benign Het
Src C T 2: 157,469,932 P527S probably damaging Het
Susd3 C T 13: 49,231,302 probably null Het
Syngap1 T C 17: 26,966,906 L1270P probably damaging Het
Taf1c G A 8: 119,598,850 P758S probably damaging Het
Tenm2 A T 11: 36,024,448 N2087K probably damaging Het
Tfrc A T 16: 32,630,151 I703F probably damaging Het
Thap1 C G 8: 26,160,846 T48S probably benign Het
Tspear T C 10: 77,866,329 F199L probably benign Het
Usp17lc A T 7: 103,418,590 H364L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vmn1r1 T C 1: 182,157,224 E292G possibly damaging Het
Vmn1r125 T G 7: 21,272,627 V150G probably damaging Het
Vmn1r167 A T 7: 23,504,692 L300I probably damaging Het
Vmn2r106 A C 17: 20,267,623 I838S probably benign Het
Wdr64 A T 1: 175,726,494 S197C probably damaging Het
Zfp248 A T 6: 118,433,307 V47E possibly damaging Het
Other mutations in Ncln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Ncln APN 10 81488596 missense probably benign
IGL03012:Ncln APN 10 81489965 missense probably benign 0.04
R0399:Ncln UTSW 10 81488297 missense probably damaging 1.00
R1203:Ncln UTSW 10 81496193 missense possibly damaging 0.48
R1436:Ncln UTSW 10 81489893 missense probably damaging 0.98
R1664:Ncln UTSW 10 81487721 missense probably benign 0.19
R2356:Ncln UTSW 10 81492922 missense probably benign 0.01
R2926:Ncln UTSW 10 81488438 missense probably benign 0.09
R3110:Ncln UTSW 10 81487685 missense probably benign 0.07
R3111:Ncln UTSW 10 81487685 missense probably benign 0.07
R3112:Ncln UTSW 10 81487685 missense probably benign 0.07
R5910:Ncln UTSW 10 81496078 critical splice donor site probably null
R6359:Ncln UTSW 10 81490284 missense probably damaging 1.00
R6809:Ncln UTSW 10 81487678 critical splice donor site probably null
R7141:Ncln UTSW 10 81487849 nonsense probably null
R7145:Ncln UTSW 10 81488252 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTAAGAAGGTGGGAGCTCAC -3'
(R):5'- TGCAGTTCCCTGAACGCATG -3'

Sequencing Primer
(F):5'- CATCTGGAAACCATTGGCTG -3'
(R):5'- TGAACGCATGCGATCCTC -3'
Posted On2015-10-08