Mutagenetix > Incidental Mutations

Incidental Mutation 'R4661:Plppr5'

500760

Institutional Source

Beutler Lab

Gene Symbol

Plppr5

Ensembl Gene

ENSMUSG00000033342

Gene Name

phospholipid phosphatase related 5

Synonyms

4833424O15Rik, Lppr5

MMRRC Submission

041600-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R4661 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

117574836-117689507 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 117620969 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 80 (I80V)

Ref Sequence

ENSEMBL: ENSMUSP00000102081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039564] [ENSMUST00000106473]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039564
AA Change: I80V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045121
Gene: ENSMUSG00000033342
AA Change: I80V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
transmembrane domain	66	88	N/A	INTRINSIC
acidPPc	123	267	8.27e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106473
AA Change: I80V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102081
Gene: ENSMUSG00000033342
AA Change: I80V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
transmembrane domain	66	88	N/A	INTRINSIC
acidPPc	123	267	8.27e-20	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type 2 member of the phosphatidic acid phosphatase (PAP) family. All type 2 members of this protein family contain 6 transmembrane regions, and a consensus N-glycosylation site. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	T	C	9: 44,287,330	N42D	probably damaging	Het
Adamdec1	G	A	14: 68,570,113	T366I	probably damaging	Het
Adamts7	C	A	9: 90,193,330	H1038Q	probably benign	Het
Aff3	T	C	1: 38,627,128	D5G	possibly damaging	Het
Amhr2	A	T	15: 102,454,253	D485V	probably damaging	Het
Arhgap35	A	T	7: 16,564,738	F134Y	probably damaging	Het
Asxl3	A	G	18: 22,516,477	T508A	probably benign	Het
Atp10a	TGGCGGCGGC	TGGCGGC	7: 58,658,500		probably benign	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Atp9a	A	G	2: 168,637,672	F928L	possibly damaging	Het
BC034090	A	T	1: 155,232,475	D13E	probably damaging	Het
Bco1	A	G	8: 117,129,241	E425G	probably benign	Het
Brsk1	T	C	7: 4,707,299	S436P	possibly damaging	Het
C1s1	T	C	6: 124,536,490	I193V	probably benign	Het
Calb2	A	G	8: 110,168,077	F21L	probably benign	Het
Catsperz	T	G	19: 6,924,803	T108P	probably benign	Het
Cep57l1	T	A	10: 41,719,771	D329V	possibly damaging	Het
Cfdp1	A	G	8: 111,830,945	F188S	probably benign	Het
Chrna2	G	A	14: 66,148,843	G146D	probably damaging	Het
Col6a1	A	C	10: 76,714,672	F520V	unknown	Het
Cyb5d2	C	A	11: 72,778,945	V43L	probably damaging	Het
Cyp2c40	T	C	19: 39,786,846	T321A	probably benign	Het
Dnajc16	A	C	4: 141,763,548	Y764D	probably damaging	Het
Dsg1a	G	A	18: 20,340,533	V888M	probably damaging	Het
F5	A	C	1: 164,184,920	T468P	probably damaging	Het
Faap24	A	G	7: 35,395,084	M97T	probably benign	Het
Fam227b	A	T	2: 126,007,310	I334N	probably damaging	Het
Frem2	G	T	3: 53,655,443	P548T	probably damaging	Het
Gfm1	A	G	3: 67,433,398	E94G	probably damaging	Het
Gm17606	A	T	14: 54,648,239		probably benign	Het
Gnb2	A	T	5: 137,530,253	M1K	probably null	Het
Gys1	G	A	7: 45,454,834	A544T	probably damaging	Het
Hdac5	T	C	11: 102,205,849	Y230C	probably damaging	Het
Hunk	A	T	16: 90,447,308		probably null	Het
Ifnl2	A	G	7: 28,510,210	F51L	probably damaging	Het
Itpr1	T	C	6: 108,410,931		probably null	Het
Kcnj1	A	G	9: 32,396,622	Y114C	probably benign	Het
Kdm4b	T	A	17: 56,399,459	S322T	probably damaging	Het
Kif27	T	C	13: 58,323,916	E786G	probably damaging	Het
Kif6	T	C	17: 49,753,881	V414A	probably benign	Het
L1td1	A	G	4: 98,733,624	K141R	possibly damaging	Het
Loxhd1	A	G	18: 77,402,885	I1394V	possibly damaging	Het
Lrfn5	A	T	12: 61,839,647	M74L	probably damaging	Het
Lrp6	C	T	6: 134,511,267	D289N	probably benign	Het
Mroh7	A	G	4: 106,691,513		probably null	Het
Muc4	A	C	16: 32,769,277	E2885A	possibly damaging	Het
Myo18b	G	T	5: 112,875,175		probably benign	Het
Ncln	G	A	10: 81,493,068	A172V	probably damaging	Het
Nek9	G	A	12: 85,320,892	T335M	possibly damaging	Het
Notch2	A	G	3: 98,135,513	Y1398C	probably damaging	Het
Olfr472	A	T	7: 107,902,981	H88L	probably benign	Het
Olfr710	T	A	7: 106,944,867	I45F	probably damaging	Het
Olfr981	A	T	9: 40,022,527	I45F	probably damaging	Het
Pax2	G	A	19: 44,760,937	V40M	probably damaging	Het
Pde6c	A	G	19: 38,169,439	Y637C	probably damaging	Het
Pold1	G	T	7: 44,532,809	P1100T	probably damaging	Het
Prune2	T	C	19: 17,000,023	Y41H	probably damaging	Het
Rgl2	C	T	17: 33,933,226	A329V	possibly damaging	Het
Rilp	T	A	11: 75,511,424	Y250N	probably damaging	Het
Rilpl1	A	G	5: 124,514,688	V19A	probably benign	Het
Rtp3	T	C	9: 110,986,451		probably null	Het
Rufy4	A	G	1: 74,133,107	K246E	probably damaging	Het
Saraf	C	A	8: 34,168,462	A306E	probably damaging	Het
Slc26a8	A	T	17: 28,638,684	N828K	probably benign	Het
Src	C	T	2: 157,469,932	P527S	probably damaging	Het
Susd3	C	T	13: 49,231,302		probably null	Het
Syngap1	T	C	17: 26,966,906	L1270P	probably damaging	Het
Taf1c	G	A	8: 119,598,850	P758S	probably damaging	Het
Tenm2	A	T	11: 36,024,448	N2087K	probably damaging	Het
Tfrc	A	T	16: 32,630,151	I703F	probably damaging	Het
Thap1	C	G	8: 26,160,846	T48S	probably benign	Het
Tspear	T	C	10: 77,866,329	F199L	probably benign	Het
Usp17lc	A	T	7: 103,418,590	H364L	probably benign	Het
Usp9x	A	G	X: 13,123,508	R776G	possibly damaging	Homo
Vmn1r1	T	C	1: 182,157,224	E292G	possibly damaging	Het
Vmn1r125	T	G	7: 21,272,627	V150G	probably damaging	Het
Vmn1r167	A	T	7: 23,504,692	L300I	probably damaging	Het
Vmn2r106	A	C	17: 20,267,623	I838S	probably benign	Het
Wdr64	A	T	1: 175,726,494	S197C	probably damaging	Het
Zfp248	A	T	6: 118,433,307	V47E	possibly damaging	Het

Other mutations in Plppr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Plppr5	APN	3	117671943	missense	possibly damaging	0.46
IGL01081:Plppr5	APN	3	117686649	utr 3 prime	probably benign
IGL01315:Plppr5	APN	3	117662526	missense	probably damaging	1.00
IGL02802:Plppr5	UTSW	3	117662579	missense	probably damaging	1.00
R0044:Plppr5	UTSW	3	117671889	splice site	probably null
R0044:Plppr5	UTSW	3	117671889	splice site	probably null
R0332:Plppr5	UTSW	3	117671932	missense	probably benign	0.05
R0757:Plppr5	UTSW	3	117575891	missense	probably benign	0.16
R1101:Plppr5	UTSW	3	117662523	missense	probably damaging	0.99
R1354:Plppr5	UTSW	3	117575847	missense	possibly damaging	0.94
R1498:Plppr5	UTSW	3	117662612	missense	probably damaging	0.97
R1967:Plppr5	UTSW	3	117625906	critical splice donor site	probably null
R2090:Plppr5	UTSW	3	117575871	missense	possibly damaging	0.63
R5143:Plppr5	UTSW	3	117625903	missense	probably benign
R5441:Plppr5	UTSW	3	117662471	missense	possibly damaging	0.94
R5722:Plppr5	UTSW	3	117621065	missense	probably benign	0.00
R6560:Plppr5	UTSW	3	117671990	missense	probably benign	0.09
R7221:Plppr5	UTSW	3	117620969	missense	probably damaging	1.00
R8556:Plppr5	UTSW	3	117672030	missense	probably benign
Z1177:Plppr5	UTSW	3	117625779	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAGTGTCTGGATGGTCCTTC -3'
(R):5'- CTAGGCTCATCTTGAAAGTTGTCTC -3'

Sequencing Primer
(F):5'- AGTGTCTGGATGGTCCTTCCTTTC -3'
(R):5'- ACCAAGAAATCGGACGGT -3'

Posted On

2017-12-01