Incidental Mutation 'R0211:Grin2a'
ID35570
Institutional Source Beutler Lab
Gene Symbol Grin2a
Ensembl Gene ENSMUSG00000059003
Gene Nameglutamate receptor, ionotropic, NMDA2A (epsilon 1)
SynonymsNR2A, GluRepsilon1, NMDAR2A, GluN2A
MMRRC Submission 038462-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R0211 (G1)
Quality Score94
Status Not validated
Chromosome16
Chromosomal Location9567898-9995560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9579173 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1017 (S1017P)
Ref Sequence ENSEMBL: ENSMUSP00000142900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032331
AA Change: S1017P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: S1017P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115835
AA Change: S1017P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: S1017P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 99 300 9.2e-11 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 1.2e-266 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199708
AA Change: S1017P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: S1017P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,216,096 L1401P possibly damaging Het
4930503B20Rik C T 3: 146,650,496 R219H probably benign Het
Abcc9 T A 6: 142,688,984 I185F probably benign Het
Adgrf1 T C 17: 43,296,690 L100P probably damaging Het
Akt1 T C 12: 112,655,142 T407A probably damaging Het
Alk C T 17: 72,603,516 R65H probably damaging Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Arhgef12 G A 9: 42,972,004 R1411C probably damaging Het
Arnt T A 3: 95,476,149 M242K probably damaging Het
Atad5 T G 11: 80,095,647 V520G probably benign Het
Avpr1a T A 10: 122,449,469 M222K possibly damaging Het
Cbr2 T A 11: 120,730,788 I88L probably benign Het
Cc2d2a T A 5: 43,688,266 probably null Het
Ccdc51 T C 9: 109,089,373 M10T probably benign Het
Cntnap5b T A 1: 100,478,374 D1136E possibly damaging Het
Coil T A 11: 88,982,153 S447T probably damaging Het
Cryba1 T A 11: 77,718,867 Y179F probably damaging Het
Dcaf4 T A 12: 83,535,961 F277I probably damaging Het
Ddost G A 4: 138,309,602 V159M probably damaging Het
Dnajb6 T C 5: 29,785,079 probably benign Het
Dnase2a A G 8: 84,908,788 probably benign Het
Dscam T C 16: 96,716,079 I877V possibly damaging Het
Dyx1c1 A T 9: 72,961,367 R127S possibly damaging Het
Efcc1 A T 6: 87,749,154 T312S probably benign Het
Ermard A T 17: 15,021,943 Q127L probably damaging Het
F2 T C 2: 91,630,158 E329G probably damaging Het
Foxc2 T A 8: 121,116,616 M1K probably null Het
Fuz T A 7: 44,899,022 probably null Het
Ggnbp2 G A 11: 84,840,313 T325M probably damaging Het
Gm6408 T A 5: 146,483,060 F115I probably benign Het
Gm8909 T C 17: 36,168,007 T117A probably damaging Het
Gp6 C T 7: 4,373,209 probably null Het
Hmmr A T 11: 40,714,808 M318K probably damaging Het
Ifi205 T C 1: 174,028,428 E12G probably benign Het
Ift74 C T 4: 94,679,255 T395I probably benign Het
Ikbkap T A 4: 56,795,545 I143F probably damaging Het
Irf8 A T 8: 120,739,975 D53V probably damaging Het
Itgad A G 7: 128,204,641 Y69C probably damaging Het
Itpr2 C A 6: 146,194,613 R2084L probably benign Het
Krt4 C A 15: 101,922,782 S228I possibly damaging Het
Lpin3 A T 2: 160,898,681 D382V probably damaging Het
Ltbp3 T C 19: 5,752,143 probably null Het
Map4k3 C T 17: 80,644,841 A179T probably damaging Het
Nck1 A T 9: 100,497,767 W144R probably damaging Het
Ndufb9 A T 15: 58,939,282 Q139L possibly damaging Het
Ngfr T G 11: 95,571,912 E300A probably damaging Het
Nin T G 12: 70,014,875 T2072P probably damaging Het
Nop2 T G 6: 125,141,344 L529R probably damaging Het
Nrm T A 17: 35,864,611 L203Q probably damaging Het
Nynrin T C 14: 55,871,798 F1454S probably benign Het
Olfr1062 A C 2: 86,423,107 S190A probably damaging Het
Olfr1328 T A 4: 118,934,270 M191L probably benign Het
Olfr1453 T C 19: 13,028,282 T16A possibly damaging Het
Os9 A G 10: 127,121,036 V27A probably damaging Het
Osbpl9 T G 4: 109,073,124 T332P probably damaging Het
Pcdhb10 A T 18: 37,414,006 M712L probably benign Het
Pcx C T 19: 4,620,199 A935V probably damaging Het
Pdzd7 A G 19: 45,033,667 V514A possibly damaging Het
Plin4 C T 17: 56,102,242 G1326D probably damaging Het
Plxnb1 T A 9: 109,103,663 Y568* probably null Het
Pmfbp1 T A 8: 109,541,740 V973D probably benign Het
Ppp2r1b T C 9: 50,861,625 V70A probably benign Het
Prkar2b C A 12: 31,972,184 V201L probably benign Het
Rgr T G 14: 37,046,968 T37P probably damaging Het
Ripk3 A T 14: 55,787,918 L63Q probably damaging Het
Rpusd2 A G 2: 119,038,412 S439G probably benign Het
Serac1 T A 17: 6,050,060 R438S possibly damaging Het
Slc19a1 T A 10: 77,038,466 S24T possibly damaging Het
Slc6a21 A C 7: 45,288,243 T653P possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spdef C T 17: 27,714,920 R309H probably damaging Het
Srp68 A T 11: 116,265,551 Y84N probably damaging Het
Syne2 A T 12: 76,097,957 Q6299L probably damaging Het
Tmem63b T A 17: 45,661,913 M652L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnk1 A G 11: 69,855,181 V306A probably damaging Het
Tnnc2 T A 2: 164,777,484 I147F probably damaging Het
Tnni3k C T 3: 155,055,344 probably benign Het
Togaram2 T A 17: 71,729,248 V911D probably damaging Het
Tyw3 T C 3: 154,587,495 N181S probably damaging Het
Unc79 T A 12: 103,072,792 S682T probably benign Het
Vps13d A G 4: 145,114,778 L2634S probably benign Het
Wasl G T 6: 24,633,893 A124E probably damaging Het
Zfp287 T C 11: 62,714,917 H388R probably damaging Het
Zfp335 T C 2: 164,907,692 T262A probably damaging Het
Zfp457 C G 13: 67,293,147 G359R probably benign Het
Zfp536 T A 7: 37,568,449 E514V probably damaging Het
Zfp872 T A 9: 22,200,173 I316N probably damaging Het
Other mutations in Grin2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Grin2a APN 16 9644130 missense probably benign 0.29
IGL03288:Grin2a APN 16 9669840 missense possibly damaging 0.85
IGL02796:Grin2a UTSW 16 9585108 missense possibly damaging 0.72
PIT4402001:Grin2a UTSW 16 9644199 missense possibly damaging 0.77
PIT4494001:Grin2a UTSW 16 9585096 missense probably damaging 0.98
R0055:Grin2a UTSW 16 9669807 missense probably damaging 0.99
R0055:Grin2a UTSW 16 9669807 missense probably damaging 0.99
R0164:Grin2a UTSW 16 9994821 critical splice donor site probably null
R0164:Grin2a UTSW 16 9994821 critical splice donor site probably null
R0390:Grin2a UTSW 16 9579585 missense possibly damaging 0.85
R0659:Grin2a UTSW 16 9992472 missense probably damaging 0.98
R0661:Grin2a UTSW 16 9992472 missense probably damaging 0.98
R0734:Grin2a UTSW 16 9579611 missense possibly damaging 0.71
R1524:Grin2a UTSW 16 9663603 missense possibly damaging 0.55
R1542:Grin2a UTSW 16 9579203 missense probably damaging 0.98
R1556:Grin2a UTSW 16 9707715 missense probably benign 0.18
R1605:Grin2a UTSW 16 9663330 missense possibly damaging 0.46
R1792:Grin2a UTSW 16 9992395 missense possibly damaging 0.53
R2024:Grin2a UTSW 16 9644243 missense possibly damaging 0.76
R2057:Grin2a UTSW 16 9669744 missense probably benign 0.14
R2344:Grin2a UTSW 16 9663235 missense probably benign 0.03
R2847:Grin2a UTSW 16 9761965 missense possibly damaging 0.73
R2848:Grin2a UTSW 16 9761965 missense possibly damaging 0.73
R2981:Grin2a UTSW 16 9644223 missense possibly damaging 0.89
R4197:Grin2a UTSW 16 9761967 missense probably damaging 1.00
R4342:Grin2a UTSW 16 9653589 missense possibly damaging 0.52
R4741:Grin2a UTSW 16 9663512 missense probably damaging 1.00
R4891:Grin2a UTSW 16 9657706 missense possibly damaging 0.51
R4925:Grin2a UTSW 16 9669823 missense probably damaging 0.98
R5563:Grin2a UTSW 16 9707717 missense probably benign 0.18
R5645:Grin2a UTSW 16 9992226 missense probably damaging 0.98
R5769:Grin2a UTSW 16 9761526 missense possibly damaging 0.89
R5885:Grin2a UTSW 16 9761905 missense possibly damaging 0.95
R6065:Grin2a UTSW 16 9761907 missense possibly damaging 0.92
R6083:Grin2a UTSW 16 9579540 missense probably benign 0.02
R6137:Grin2a UTSW 16 9653449 missense probably benign 0.32
R6286:Grin2a UTSW 16 9761775 missense possibly damaging 0.93
R6342:Grin2a UTSW 16 9579334 missense probably damaging 0.98
R6697:Grin2a UTSW 16 9669840 missense possibly damaging 0.85
R6924:Grin2a UTSW 16 9663228 missense possibly damaging 0.71
R7070:Grin2a UTSW 16 9579424 missense possibly damaging 0.92
R7235:Grin2a UTSW 16 9579265 missense probably damaging 0.98
R7274:Grin2a UTSW 16 9579122 missense possibly damaging 0.71
R7669:Grin2a UTSW 16 9992463 missense probably benign
X0024:Grin2a UTSW 16 9663199 missense probably benign 0.36
Z1177:Grin2a UTSW 16 9663577 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GGGAAGTCCACATTCTCAGGCAAG -3'
(R):5'- CCAACAGGCACAAGGATAGTCTCAG -3'

Sequencing Primer
(F):5'- GTAGATCTTATCCCTGGGAGAAC -3'
(R):5'- CAGTAACTATGTGTTTCAGGGACAG -3'
Posted On2013-05-09