Mutagenetix > Incidental Mutation

Incidental Mutation 'R4730:Aff1'

358749

Institutional Source

Beutler Lab

Gene Symbol

Aff1

Ensembl Gene

ENSMUSG00000029313

Gene Name

AF4/FMR2 family, member 1

Synonyms

9630032B01Rik, Af4, Rob, Mllt2h

MMRRC Submission

041990-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.381) question?

Stock #

R4730 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103692374-103855322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103843073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 963 (Q963R)

Ref Sequence

ENSEMBL: ENSMUSP00000059744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031256] [ENSMUST00000054979] [ENSMUST00000153165]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031256
AA Change: Q971R

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031256
Gene: ENSMUSG00000029313
AA Change: Q971R

Domain	Start	End	E-Value	Type
Pfam:AF-4	16	1223	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054979
AA Change: Q963R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000059744
Gene: ENSMUSG00000029313
AA Change: Q963R

Domain	Start	End	E-Value	Type
Pfam:AF-4	8	1216	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153165

SMART Domains

Protein: ENSMUSP00000119631
Gene: ENSMUSG00000029313

Domain	Start	End	E-Value	Type
Pfam:AF-4	16	871	N/A	PFAM

Meta Mutation Damage Score

0.0970

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: This gene encodes a member of the AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome family of proteins, which have been implicated in human childhood lymphoblastic leukemia, Fragile X E site mental retardation, and ataxia. It is the prevalent mixed-lineage leukemia fusion gene associated with spontaneous acute lymphoblastic leukemia. Members of this family have three conserved domains: an N-terminal homology domain, an AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome domain, and a C-terminal homology domain. Knockout of the mouse gene by homologous recombination severely affects early events in lymphopoiesis, including precursor proliferation or recruitment, but is dispensable for terminal differentiation. In addition, an autosomal dominant missense mutation results in several phenotypes including ataxia and adult-onset Purkinje cell loss in the cerebellum, indicating a role in Purkinje cell maintenance and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired B and T cell development. Heterozygotes for an ENU-induced mutation exhibit small size, ataxia, adult-onset Purkinje cell loss, cataracts, reduced survival, and low fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef28	C	T	13: 97,978,142	E645K	probably benign	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Col4a2	A	G	8: 11,437,590	N964S	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Duox1	T	G	2: 122,333,831	L924R	probably damaging	Het
Edem2	T	C	2: 155,705,698	E398G	possibly damaging	Het
Engase	A	G	11: 118,482,922	N297D	probably damaging	Het
Esp4	A	C	17: 40,602,554	Y104S	unknown	Het
Esp4	C	A	17: 40,602,555	Y104*	probably null	Het
Fat1	A	T	8: 45,033,477	N3356I	probably damaging	Het
Gm3867	T	A	9: 36,257,254		noncoding transcript	Het
Gm6818	C	T	7: 38,402,494		noncoding transcript	Het
Grip2	T	C	6: 91,785,712	*175W	probably null	Het
Gucy1b2	A	G	14: 62,407,759	V617A	probably damaging	Het
Gzmc	C	T	14: 56,231,632	C210Y	probably damaging	Het
Hmg20a	T	A	9: 56,467,419	S20T	possibly damaging	Het
Hs3st1	A	T	5: 39,614,805	L165*	probably null	Het
Ighv1-26	A	G	12: 114,788,789	I6T	probably benign	Het
Kcnk13	A	G	12: 100,061,715	K350E	probably damaging	Het
Lin9	T	A	1: 180,665,851	L198*	probably null	Het
Lrfn5	C	T	12: 61,840,719	A431V	probably benign	Het
Lta	C	T	17: 35,204,089	R86Q	probably benign	Het
Map3k4	T	A	17: 12,248,974	I1058L	probably damaging	Het
Mtif2	T	A	11: 29,540,834	S513T	probably benign	Het
Muc4	C	T	16: 32,751,214	T364I	possibly damaging	Het
Nav1	C	A	1: 135,607,311		probably benign	Het
Nfrkb	T	C	9: 31,410,251	V748A	probably benign	Het
Obox6	A	T	7: 15,834,813	M46K	possibly damaging	Het
Olfr1002	T	C	2: 85,647,992	T110A	probably benign	Het
Olfr1013	G	T	2: 85,770,061	E87*	probably null	Het
Olfr1102	C	T	2: 87,002,166	R66W	possibly damaging	Het
Olfr172	T	C	16: 58,760,742	I145V	probably benign	Het
Olfr820	G	A	10: 130,017,547	R62Q	probably damaging	Het
P4htm	A	G	9: 108,579,772	V412A	possibly damaging	Het
Phb2	T	C	6: 124,713,123	S92P	probably damaging	Het
Phtf1	G	T	3: 103,987,435	R147L	probably damaging	Het
Pigk	C	T	3: 152,742,566	Q189*	probably null	Het
Plxnc1	G	A	10: 94,867,468		probably benign	Het
Prrx1	A	G	1: 163,312,613	V8A	probably benign	Het
Ptprg	G	A	14: 12,213,713	G252D	probably damaging	Het
Rnf4	G	T	5: 34,350,803	V134F	possibly damaging	Het
Scarf2	A	G	16: 17,803,013	T182A	probably damaging	Het
Setd1a	A	G	7: 127,797,330		probably benign	Het
Sgpp1	A	G	12: 75,734,939	F209L	probably benign	Het
Sh3d19	T	A	3: 86,116,864	S567T	possibly damaging	Het
Slc4a2	C	T	5: 24,434,880	R520W	probably damaging	Het
Slf1	T	C	13: 77,046,632	Q858R	probably damaging	Het
Slitrk3	G	T	3: 73,049,519	A640E	probably benign	Het
Smarca2	A	G	19: 26,630,673	Y44C	probably damaging	Het
Spon1	A	G	7: 114,033,071	E543G	possibly damaging	Het
Strn4	A	G	7: 16,828,794	Q286R	possibly damaging	Het
Suz12	T	C	11: 80,002,162		probably benign	Het
Syna	T	A	5: 134,558,586	E503V	probably damaging	Het
Syt14	C	T	1: 192,930,786	D569N	probably damaging	Het
Sytl2	A	G	7: 90,381,249		probably benign	Het
Tmprss11g	G	T	5: 86,489,232	S335*	probably null	Het
Tmprss11g	A	T	5: 86,489,233	S335T	probably damaging	Het
Trim66	A	G	7: 109,483,069	S226P	probably damaging	Het
Tubgcp3	T	C	8: 12,657,654	T112A	probably benign	Het
Ulk4	T	C	9: 121,263,725	S149G	probably benign	Het
Usp53	T	C	3: 122,962,933	D108G	probably null	Het
Vmn1r91	A	T	7: 20,101,770	T205S	possibly damaging	Het

Other mutations in Aff1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Aff1	APN	5	103784077	missense	probably damaging	1.00
IGL02060:Aff1	APN	5	103783849	missense	possibly damaging	0.51
IGL02081:Aff1	APN	5	103834305	missense	probably damaging	1.00
IGL02108:Aff1	APN	5	103811109	critical splice donor site	probably null
IGL03056:Aff1	APN	5	103811081	missense	probably damaging	0.99
IGL03332:Aff1	APN	5	103841105	nonsense	probably null
IGL03340:Aff1	APN	5	103783804	missense	possibly damaging	0.76
IGL03382:Aff1	APN	5	103841060	missense	possibly damaging	0.86
PIT4495001:Aff1	UTSW	5	103849525	missense	probably benign	0.16
R0013:Aff1	UTSW	5	103828484	nonsense	probably null
R0219:Aff1	UTSW	5	103811040	splice site	probably benign
R0520:Aff1	UTSW	5	103847751	nonsense	probably null
R0607:Aff1	UTSW	5	103828454	missense	probably damaging	1.00
R0883:Aff1	UTSW	5	103826138	splice site	probably benign
R1662:Aff1	UTSW	5	103841057	missense	probably damaging	0.99
R1730:Aff1	UTSW	5	103833512	missense	probably damaging	1.00
R1850:Aff1	UTSW	5	103833907	missense	probably damaging	1.00
R3411:Aff1	UTSW	5	103754706	start codon destroyed	probably null	0.53
R4007:Aff1	UTSW	5	103784222	missense	probably benign	0.15
R4207:Aff1	UTSW	5	103818988	critical splice donor site	probably null
R4702:Aff1	UTSW	5	103811069	missense	probably damaging	1.00
R4784:Aff1	UTSW	5	103847039	nonsense	probably null
R5166:Aff1	UTSW	5	103754657	start gained	probably benign
R5294:Aff1	UTSW	5	103811157	intron	probably benign
R5435:Aff1	UTSW	5	103754332	unclassified	probably benign
R5436:Aff1	UTSW	5	103783870	missense	probably damaging	1.00
R6065:Aff1	UTSW	5	103842252	missense	probably damaging	1.00
R6114:Aff1	UTSW	5	103842297	missense	probably damaging	0.97
R6298:Aff1	UTSW	5	103754720	missense	possibly damaging	0.68
R7095:Aff1	UTSW	5	103843085	missense	probably damaging	0.97
R7261:Aff1	UTSW	5	103828379	missense	probably damaging	0.97
R7350:Aff1	UTSW	5	103847092	missense	probably benign	0.28
R7423:Aff1	UTSW	5	103847101	missense	probably damaging	1.00
R7469:Aff1	UTSW	5	103833547	missense	probably benign	0.00
R7604:Aff1	UTSW	5	103847809	missense	probably benign	0.09
R7607:Aff1	UTSW	5	103849459	missense	possibly damaging	0.72
R8014:Aff1	UTSW	5	103833869	missense	possibly damaging	0.82
R8219:Aff1	UTSW	5	103846333	missense	probably damaging	1.00
R8315:Aff1	UTSW	5	103811090	missense	probably damaging	0.99
R8837:Aff1	UTSW	5	103834212	missense	possibly damaging	0.77
R8957:Aff1	UTSW	5	103833768	missense	possibly damaging	0.82
R9159:Aff1	UTSW	5	103842265	missense	possibly damaging	0.89
R9377:Aff1	UTSW	5	103833819	missense	probably damaging	0.96
R9381:Aff1	UTSW	5	103833867	missense	possibly damaging	0.85
R9705:Aff1	UTSW	5	103784410	missense	possibly damaging	0.88
R9725:Aff1	UTSW	5	103847065	missense	probably damaging	0.99
R9764:Aff1	UTSW	5	103849499	missense	probably damaging	1.00
Z1177:Aff1	UTSW	5	103783753	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- ACTCTCCTGGCTTTGGAAGG -3'
(R):5'- CCACTGTTTAATCAAGGGCATGG -3'

Sequencing Primer
(F):5'- AAGGCTGGCGCTGCTAG -3'
(R):5'- TGGGAACAGAGACTGACCATTGTC -3'

Posted On

2015-11-11