Incidental Mutation 'R4805:Olfr329-ps'
ID370634
Institutional Source Beutler Lab
Gene Symbol Olfr329-ps
Ensembl Gene ENSMUSG00000064252
Gene Nameolfactory receptor 329, pseudogene
SynonymsMOR275-6P, GA_x6K02T2NKPP-882068-883006
MMRRC Submission 041999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R4805 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58539801-58546422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58542570 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 315 (T315I)
Ref Sequence ENSEMBL: ENSMUSP00000104450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108822] [ENSMUST00000108823] [ENSMUST00000134055] [ENSMUST00000219448]
Predicted Effect probably benign
Transcript: ENSMUST00000108822
AA Change: T315I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104450
Gene: ENSMUSG00000064252
AA Change: T315I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108823
AA Change: T302I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104451
Gene: ENSMUSG00000064252
AA Change: T302I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.4e-35 PFAM
Pfam:7tm_4 137 281 5.8e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134055
AA Change: T302I
SMART Domains Protein: ENSMUSP00000145126
Gene: ENSMUSG00000050818
AA Change: T302I

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.6e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 309 4.4e-6 PFAM
Pfam:7tm_1 45 294 2.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204252
SMART Domains Protein: ENSMUSP00000145167
Gene: ENSMUSG00000064252

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 158 4.3e-6 PFAM
Pfam:7tm_4 35 157 5.9e-19 PFAM
Pfam:7tm_1 45 158 2.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219448
AA Change: T302I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T A 15: 84,417,196 H82L probably damaging Het
4930407I10Rik T A 15: 82,066,427 Y1508* probably null Het
4931414P19Rik T C 14: 54,595,454 E88G probably benign Het
Acaa1b A G 9: 119,156,946 S17P probably benign Het
Arhgef7 G A 8: 11,831,552 E565K probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bpnt1 T A 1: 185,345,307 probably null Het
Ccnt1 C T 15: 98,544,308 V360I probably benign Het
Chd4 T C 6: 125,128,945 S1829P possibly damaging Het
Dennd1b A T 1: 139,053,384 N112I probably damaging Het
Fat2 A T 11: 55,283,979 D1969E probably benign Het
Flywch1 A C 17: 23,760,617 D394E probably benign Het
Gal3st4 T A 5: 138,265,471 probably null Het
Gm14403 T C 2: 177,508,699 L146P probably damaging Het
Gm5283 G T 3: 17,230,959 noncoding transcript Het
Gpr161 T A 1: 165,306,460 L97Q probably damaging Het
Gstm2 A T 3: 107,985,095 M105K possibly damaging Het
Hecw2 A G 1: 53,840,859 Y1264H probably damaging Het
Ifi206 T A 1: 173,481,386 Q348L possibly damaging Het
Ighv1-83 A T 12: 115,963,869 M87K possibly damaging Het
Ighv2-7 A T 12: 113,807,534 S44T probably damaging Het
Ipo7 T A 7: 110,051,484 N884K probably benign Het
Itga2b T C 11: 102,467,866 N75S probably benign Het
Krt20 A G 11: 99,428,985 V431A unknown Het
Krt24 A T 11: 99,283,626 I205N possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc31 A T 3: 30,691,297 L67* probably null Het
Lrrc37a A G 11: 103,504,309 F97L probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mgat4d T G 8: 83,358,158 probably null Het
Mrgprb3 C T 7: 48,643,306 V166I probably benign Het
Myh11 T A 16: 14,234,465 Q379L possibly damaging Het
Myh7 T C 14: 54,985,133 S782G probably benign Het
Nobox T C 6: 43,305,119 D340G probably damaging Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr1453 T A 19: 13,028,297 I11F probably benign Het
Pikfyve T A 1: 65,268,800 I1845N probably damaging Het
Pramef20 A G 4: 144,377,020 Y179H probably benign Het
Rad21l T G 2: 151,668,007 H58P probably damaging Het
Scnn1g T C 7: 121,746,602 L316S probably damaging Het
Serpina5 G A 12: 104,102,201 V174I probably damaging Het
Shank1 T C 7: 44,343,711 S788P unknown Het
Snap47 A G 11: 59,428,517 V265A possibly damaging Het
Steap3 T A 1: 120,243,886 H163L probably benign Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tet2 A G 3: 133,467,315 F1729L probably benign Het
Thsd7b T C 1: 130,188,539 V1343A probably benign Het
Thumpd2 G A 17: 81,026,701 T486I probably damaging Het
Ttc41 G T 10: 86,729,798 M405I possibly damaging Het
Ttn T C 2: 76,747,529 D24340G probably damaging Het
Vmn1r10 T G 6: 57,113,617 F65V possibly damaging Het
Vmn2r118 G T 17: 55,592,581 D774E probably damaging Het
Vmn2r13 C T 5: 109,156,465 C700Y probably damaging Het
Wsb1 A C 11: 79,240,391 M393R possibly damaging Het
Zmat3 A G 3: 32,343,355 Y214H probably benign Het
Zswim3 C T 2: 164,820,179 T193I possibly damaging Het
Other mutations in Olfr329-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0744:Olfr329-ps UTSW 11 58543162 missense possibly damaging 0.76
R2426:Olfr329-ps UTSW 11 58543094 nonsense probably null
R6498:Olfr329-ps UTSW 11 58542582 missense probably damaging 1.00
R7341:Olfr329-ps UTSW 11 58542707 nonsense probably null
R7768:Olfr329-ps UTSW 11 58542640 missense probably damaging 0.99
R7768:Olfr329-ps UTSW 11 58542867 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCAAACTGGACAGATTACAAGTAG -3'
(R):5'- CTCAGGATGAACTCAGCAGAGG -3'

Sequencing Primer
(F):5'- CACAATGATTCTTCAAAAAGGGATG -3'
(R):5'- CAGGAAGAAGGCCCTTGC -3'
Posted On2016-02-04