Incidental Mutation 'R4859:Evc'
ID372308
Institutional Source Beutler Lab
Gene Symbol Evc
Ensembl Gene ENSMUSG00000029122
Gene NameEvC ciliary complex subunit 1
Synonyms
MMRRC Submission 042470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R4859 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location37289098-37336894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37300909 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 85 (T85A)
Ref Sequence ENSEMBL: ENSMUSP00000114825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031005] [ENSMUST00000114154] [ENSMUST00000146568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031005
AA Change: T933A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031005
Gene: ENSMUSG00000029122
AA Change: T933A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 77 92 N/A INTRINSIC
low complexity region 173 183 N/A INTRINSIC
low complexity region 449 472 N/A INTRINSIC
low complexity region 640 652 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
coiled coil region 694 725 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
coiled coil region 871 911 N/A INTRINSIC
low complexity region 927 944 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114154
AA Change: T756A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109791
Gene: ENSMUSG00000029122
AA Change: T756A

DomainStartEndE-ValueType
low complexity region 272 295 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
coiled coil region 517 548 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
coiled coil region 694 734 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000139550
AA Change: T24A
SMART Domains Protein: ENSMUSP00000120191
Gene: ENSMUSG00000029122
AA Change: T24A

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146568
AA Change: T85A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114825
Gene: ENSMUSG00000029122
AA Change: T85A

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
low complexity region 79 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202004
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a leucine zipper and a transmembrane domain. This gene has been implicated in both Ellis-van Creveld syndrome (EvC) and Weyers acrodental dysostosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some lethality shortly after birth and exhibit aphagia, infertile, teeth abnormalities, short limbs and long bones, delays in ossification, and short ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik G T 11: 29,825,178 A93E probably damaging Het
Adam25 T A 8: 40,754,543 V282E probably benign Het
Adam26b T C 8: 43,520,259 T569A possibly damaging Het
Adam6a A G 12: 113,545,989 N661D probably damaging Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adhfe1 A G 1: 9,558,213 Y270C probably damaging Het
Aldh16a1 C T 7: 45,147,307 R256H probably benign Het
Ap5z1 T C 5: 142,473,993 M466T possibly damaging Het
Aspm C T 1: 139,469,393 L908F probably damaging Het
Atp8b2 T A 3: 89,945,980 T743S probably benign Het
Bag2 G T 1: 33,746,941 T100K probably damaging Het
Camk2a A G 18: 60,943,174 probably benign Het
Ccdc158 A G 5: 92,633,403 Y848H probably damaging Het
Ccp110 T G 7: 118,725,430 V725G possibly damaging Het
Cdh6 A G 15: 13,051,332 V405A probably benign Het
Ces2g T C 8: 104,967,462 probably null Het
Cfap157 A G 2: 32,777,542 F510L probably benign Het
Chd3 A T 11: 69,359,896 M669K possibly damaging Het
Cnot10 C T 9: 114,627,464 A168T probably damaging Het
Crybg1 A G 10: 43,992,569 V1371A probably damaging Het
Dars2 A G 1: 161,044,990 L547P probably damaging Het
Dis3 A G 14: 99,087,790 C483R probably damaging Het
Dnah7b T A 1: 46,356,602 L3888Q probably damaging Het
Dpysl2 A T 14: 66,829,439 Y182N probably damaging Het
Eif4g1 T A 16: 20,682,173 F509L probably benign Het
Fam196b A G 11: 34,403,154 S399G probably benign Het
Farsb T C 1: 78,467,972 T283A probably benign Het
Fgf14 C A 14: 124,192,433 R30L possibly damaging Het
Gbe1 T C 16: 70,478,401 L363P probably damaging Het
Gcg A G 2: 62,476,845 V124A probably damaging Het
Glb1l A G 1: 75,200,319 probably benign Het
Gm11757 A G 4: 73,887,220 S351P probably damaging Het
Gm5431 T C 11: 48,889,582 E449G probably damaging Het
Gon4l T C 3: 88,895,348 S1089P probably benign Het
Hgd T C 16: 37,588,749 L25P probably damaging Het
Hnf1a T C 5: 114,955,252 H318R possibly damaging Het
Hsd17b7 A C 1: 169,967,257 V71G possibly damaging Het
Hydin T C 8: 110,506,494 S1742P possibly damaging Het
Kank2 T C 9: 21,779,782 E552G probably benign Het
Kcnq4 C A 4: 120,716,613 R217L probably damaging Het
Klrg2 T C 6: 38,627,605 *201W probably null Het
Kndc1 T C 7: 139,921,905 S953P probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lonp1 A G 17: 56,626,587 V96A probably benign Het
Mgat4e T C 1: 134,541,740 K189E possibly damaging Het
Msh2 G A 17: 87,718,759 V722I possibly damaging Het
N4bp2 T C 5: 65,825,298 Y1632H probably damaging Het
Nlrc4 T G 17: 74,436,037 K862T probably damaging Het
Notch4 A T 17: 34,587,180 Q1750L probably damaging Het
Obscn C T 11: 59,082,023 V2066I possibly damaging Het
Olfr1031 T C 2: 85,992,731 S305P probably damaging Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr1307 A T 2: 111,944,811 I215N probably damaging Het
Olfr1396 T C 11: 49,113,166 K187E probably damaging Het
Olfr607 A T 7: 103,461,036 Y57* probably null Het
Pde7a T A 3: 19,241,491 probably benign Het
Pign A T 1: 105,648,167 Y249* probably null Het
Ppp1r17 A T 6: 56,026,464 E87D probably damaging Het
Prss3 T A 6: 41,373,923 Q211L probably damaging Het
Rapgef6 A G 11: 54,636,163 E413G probably benign Het
Rnf150 A G 8: 82,864,083 H25R probably damaging Het
Scamp2 T C 9: 57,581,651 probably null Het
Scap T A 9: 110,374,342 probably benign Het
Sdc2 A C 15: 33,032,456 K175N probably damaging Het
Serpinb6d T A 13: 33,667,564 probably null Het
Sh3tc2 A G 18: 62,013,093 N1181S probably benign Het
Slc44a2 T C 9: 21,348,145 I46T probably damaging Het
Slfn8 A G 11: 83,017,714 M1T probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Soga3 A C 10: 29,150,394 M491L probably benign Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tbck T G 3: 132,801,527 S753R probably benign Het
Tdp1 A G 12: 99,909,811 I340M probably benign Het
Tmprss6 T A 15: 78,446,677 Y50F probably damaging Het
Trank1 T A 9: 111,365,010 S701T probably benign Het
Trbv17 A T 6: 41,163,289 N26I probably benign Het
Trip12 A T 1: 84,793,810 S248T probably damaging Het
Vmn2r53 T G 7: 12,601,403 Q110P probably damaging Het
Vmn2r75 A G 7: 86,148,403 V734A probably benign Het
Wfdc11 A T 2: 164,665,495 M14K probably null Het
Xcr1 T A 9: 123,856,647 M17L probably benign Het
Zbtb40 A G 4: 136,988,759 I965T probably damaging Het
Zfp760 A T 17: 21,723,530 H562L probably damaging Het
Zfp760 A T 17: 21,723,535 R564* probably null Het
Znf41-ps T A 4: 145,828,713 noncoding transcript Het
Zyg11a A T 4: 108,210,190 I41N probably damaging Het
Other mutations in Evc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Evc APN 5 37333013 missense probably damaging 1.00
IGL01799:Evc APN 5 37324914 missense possibly damaging 0.46
IGL01806:Evc APN 5 37320234 critical splice donor site probably null
IGL01823:Evc APN 5 37328521 missense probably damaging 1.00
IGL02821:Evc APN 5 37326396 missense probably benign 0.01
R0312:Evc UTSW 5 37328541 missense possibly damaging 0.83
R0355:Evc UTSW 5 37316312 splice site probably benign
R0741:Evc UTSW 5 37326395 missense possibly damaging 0.51
R0745:Evc UTSW 5 37319059 missense probably damaging 0.99
R1498:Evc UTSW 5 37323700 missense possibly damaging 0.66
R1517:Evc UTSW 5 37319035 missense probably damaging 1.00
R2680:Evc UTSW 5 37310237 missense probably benign
R2867:Evc UTSW 5 37316275 intron probably benign
R4585:Evc UTSW 5 37323713 missense probably damaging 0.96
R4586:Evc UTSW 5 37323713 missense probably damaging 0.96
R4731:Evc UTSW 5 37323797 missense probably benign 0.38
R4963:Evc UTSW 5 37322049 critical splice donor site probably null
R5536:Evc UTSW 5 37326583 splice site probably benign
R5693:Evc UTSW 5 37320240 missense possibly damaging 0.46
R5781:Evc UTSW 5 37326570 missense probably damaging 1.00
R6251:Evc UTSW 5 37300499 missense probably benign
R7061:Evc UTSW 5 37319102 missense possibly damaging 0.66
R7286:Evc UTSW 5 37322183 nonsense probably null
R7503:Evc UTSW 5 37300767 missense unknown
X0012:Evc UTSW 5 37300729 intron probably benign
Predicted Primers PCR Primer
(F):5'- GAGCACCTTGAGAAGAGTCATTCC -3'
(R):5'- AACAAGGAACCTGGTGCACC -3'

Sequencing Primer
(F):5'- TTGAGAAGAGTCATTCCCAGACTC -3'
(R):5'- CTCTGTCAAGAGCAGGCTGTG -3'
Posted On2016-03-01