Mutagenetix > Incidental Mutation

Incidental Mutation 'R4859:Trip12'

372287

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

042470-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4859 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84793810 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 248 (S248T)

Ref Sequence

ENSEMBL: ENSMUSP00000139682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894] [ENSMUST00000187818] [ENSMUST00000189496] [ENSMUST00000190067]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: S206T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: S206T

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000185909
AA Change: S248T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219
AA Change: S248T

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: S206T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: S206T

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: S206T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: S206T

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186894
AA Change: S206T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: S206T

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	3e-20	SMART
PDB:1WA5\|B	447	641	7e-6	PDB
Blast:ARM	476	516	6e-6	BLAST
WWE	764	839	6.9e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187818

SMART Domains

Protein: ENSMUSP00000140917
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000189496
AA Change: S248T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000139682
Gene: ENSMUSG00000026219
AA Change: S248T

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190067

SMART Domains

Protein: ENSMUSP00000140817
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190464

Meta Mutation Damage Score

0.0963

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.5%

Validation Efficiency

100% (112/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	G	T	11: 29,825,178	A93E	probably damaging	Het
Adam25	T	A	8: 40,754,543	V282E	probably benign	Het
Adam26b	T	C	8: 43,520,259	T569A	possibly damaging	Het
Adam6a	A	G	12: 113,545,989	N661D	probably damaging	Het
Adck1	G	A	12: 88,441,095	A199T	probably benign	Het
Adhfe1	A	G	1: 9,558,213	Y270C	probably damaging	Het
Aldh16a1	C	T	7: 45,147,307	R256H	probably benign	Het
Ap5z1	T	C	5: 142,473,993	M466T	possibly damaging	Het
Aspm	C	T	1: 139,469,393	L908F	probably damaging	Het
Atp8b2	T	A	3: 89,945,980	T743S	probably benign	Het
Bag2	G	T	1: 33,746,941	T100K	probably damaging	Het
Camk2a	A	G	18: 60,943,174		probably benign	Het
Ccdc158	A	G	5: 92,633,403	Y848H	probably damaging	Het
Ccp110	T	G	7: 118,725,430	V725G	possibly damaging	Het
Cdh6	A	G	15: 13,051,332	V405A	probably benign	Het
Ces2g	T	C	8: 104,967,462		probably null	Het
Cfap157	A	G	2: 32,777,542	F510L	probably benign	Het
Chd3	A	T	11: 69,359,896	M669K	possibly damaging	Het
Cnot10	C	T	9: 114,627,464	A168T	probably damaging	Het
Crybg1	A	G	10: 43,992,569	V1371A	probably damaging	Het
Dars2	A	G	1: 161,044,990	L547P	probably damaging	Het
Dis3	A	G	14: 99,087,790	C483R	probably damaging	Het
Dnah7b	T	A	1: 46,356,602	L3888Q	probably damaging	Het
Dpysl2	A	T	14: 66,829,439	Y182N	probably damaging	Het
Eif4g1	T	A	16: 20,682,173	F509L	probably benign	Het
Evc	T	C	5: 37,300,909	T85A	probably damaging	Het
Fam196b	A	G	11: 34,403,154	S399G	probably benign	Het
Farsb	T	C	1: 78,467,972	T283A	probably benign	Het
Fgf14	C	A	14: 124,192,433	R30L	possibly damaging	Het
Gbe1	T	C	16: 70,478,401	L363P	probably damaging	Het
Gcg	A	G	2: 62,476,845	V124A	probably damaging	Het
Glb1l	A	G	1: 75,200,319		probably benign	Het
Gm11757	A	G	4: 73,887,220	S351P	probably damaging	Het
Gm5431	T	C	11: 48,889,582	E449G	probably damaging	Het
Gon4l	T	C	3: 88,895,348	S1089P	probably benign	Het
Hgd	T	C	16: 37,588,749	L25P	probably damaging	Het
Hnf1a	T	C	5: 114,955,252	H318R	possibly damaging	Het
Hsd17b7	A	C	1: 169,967,257	V71G	possibly damaging	Het
Hydin	T	C	8: 110,506,494	S1742P	possibly damaging	Het
Kank2	T	C	9: 21,779,782	E552G	probably benign	Het
Kcnq4	C	A	4: 120,716,613	R217L	probably damaging	Het
Klrg2	T	C	6: 38,627,605	*201W	probably null	Het
Kndc1	T	C	7: 139,921,905	S953P	probably benign	Het
Lama2	TTTGCGCATT	TTT	10: 27,043,643		probably null	Het
Lonp1	A	G	17: 56,626,587	V96A	probably benign	Het
Mgat4e	T	C	1: 134,541,740	K189E	possibly damaging	Het
Msh2	G	A	17: 87,718,759	V722I	possibly damaging	Het
N4bp2	T	C	5: 65,825,298	Y1632H	probably damaging	Het
Nlrc4	T	G	17: 74,436,037	K862T	probably damaging	Het
Notch4	A	T	17: 34,587,180	Q1750L	probably damaging	Het
Obscn	C	T	11: 59,082,023	V2066I	possibly damaging	Het
Olfr1031	T	C	2: 85,992,731	S305P	probably damaging	Het
Olfr1211	T	A	2: 88,930,283	I11L	probably benign	Het
Olfr1307	A	T	2: 111,944,811	I215N	probably damaging	Het
Olfr1396	T	C	11: 49,113,166	K187E	probably damaging	Het
Olfr607	A	T	7: 103,461,036	Y57*	probably null	Het
Pde7a	T	A	3: 19,241,491		probably benign	Het
Pign	A	T	1: 105,648,167	Y249*	probably null	Het
Ppp1r17	A	T	6: 56,026,464	E87D	probably damaging	Het
Prss3	T	A	6: 41,373,923	Q211L	probably damaging	Het
Rapgef6	A	G	11: 54,636,163	E413G	probably benign	Het
Rnf150	A	G	8: 82,864,083	H25R	probably damaging	Het
Scamp2	T	C	9: 57,581,651		probably null	Het
Scap	T	A	9: 110,374,342		probably benign	Het
Sdc2	A	C	15: 33,032,456	K175N	probably damaging	Het
Serpinb6d	T	A	13: 33,667,564		probably null	Het
Sh3tc2	A	G	18: 62,013,093	N1181S	probably benign	Het
Slc44a2	T	C	9: 21,348,145	I46T	probably damaging	Het
Slfn8	A	G	11: 83,017,714	M1T	probably null	Het
Slitrk6	T	C	14: 110,751,883	T131A	probably damaging	Het
Soga3	A	C	10: 29,150,394	M491L	probably benign	Het
Spata1	C	G	3: 146,469,774	D326H	probably damaging	Het
Tbck	T	G	3: 132,801,527	S753R	probably benign	Het
Tdp1	A	G	12: 99,909,811	I340M	probably benign	Het
Tmprss6	T	A	15: 78,446,677	Y50F	probably damaging	Het
Trank1	T	A	9: 111,365,010	S701T	probably benign	Het
Trbv17	A	T	6: 41,163,289	N26I	probably benign	Het
Vmn2r53	T	G	7: 12,601,403	Q110P	probably damaging	Het
Vmn2r75	A	G	7: 86,148,403	V734A	probably benign	Het
Wfdc11	A	T	2: 164,665,495	M14K	probably null	Het
Xcr1	T	A	9: 123,856,647	M17L	probably benign	Het
Zbtb40	A	G	4: 136,988,759	I965T	probably damaging	Het
Zfp760	A	T	17: 21,723,530	H562L	probably damaging	Het
Zfp760	A	T	17: 21,723,535	R564*	probably null	Het
Znf41-ps	T	A	4: 145,828,713		noncoding transcript	Het
Zyg11a	A	T	4: 108,210,190	I41N	probably damaging	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTAGGCTAACTTTGGGGC -3'
(R):5'- CTGCTGGTAGTTCACGGAATCAG -3'

Sequencing Primer
(F):5'- CTAACTTTGGGGCTGAAGCGAG -3'
(R):5'- CTGGTAGTTCACGGAATCAGAAAAG -3'

Posted On

2016-03-01