Incidental Mutation 'R4826:Fam193a'
List |< first << previous [record 17 of 60] next >> last >|
ID374139
Institutional Source Beutler Lab
Gene Symbol Fam193a
Ensembl Gene ENSMUSG00000037210
Gene Namefamily with sequence similarity 193, member A
Synonyms
MMRRC Submission 042442-MU
Accession Numbers

Ncbi RefSeq: NM_001243123.1; MGI:2447768

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4826 (G1)
Quality Score204
Status Validated
Chromosome5
Chromosomal Location34369933-34486456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34436531 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 124 (E124G)
Ref Sequence ENSEMBL: ENSMUSP00000092463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094867] [ENSMUST00000180376] [ENSMUST00000202503]
Predicted Effect probably damaging
Transcript: ENSMUST00000094867
AA Change: E124G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092463
Gene: ENSMUSG00000037210
AA Change: E124G

DomainStartEndE-ValueType
coiled coil region 113 141 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
low complexity region 347 368 N/A INTRINSIC
low complexity region 584 593 N/A INTRINSIC
low complexity region 608 643 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 763 785 N/A INTRINSIC
low complexity region 819 832 N/A INTRINSIC
coiled coil region 879 946 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1052 1063 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
Pfam:FAM193_C 1174 1230 3.5e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180376
AA Change: E410G

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138082
Gene: ENSMUSG00000037210
AA Change: E410G

DomainStartEndE-ValueType
SCOP:d1gvp__ 70 93 4e-3 SMART
coiled coil region 399 427 N/A INTRINSIC
low complexity region 544 556 N/A INTRINSIC
low complexity region 633 654 N/A INTRINSIC
low complexity region 870 879 N/A INTRINSIC
low complexity region 894 929 N/A INTRINSIC
low complexity region 962 977 N/A INTRINSIC
low complexity region 1049 1071 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1165 1232 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1338 1349 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202503
AA Change: E40G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143922
Gene: ENSMUSG00000037210
AA Change: E40G

DomainStartEndE-ValueType
coiled coil region 29 57 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
Allele List at MGI

All alleles(19) : Gene trapped(19)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Fam193a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Fam193a APN 5 34431193 missense probably damaging 0.99
IGL02111:Fam193a APN 5 34410657 missense possibly damaging 0.72
IGL02139:Fam193a APN 5 34444737 missense probably benign 0.12
IGL02218:Fam193a APN 5 34443588 missense possibly damaging 0.68
BB010:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
BB020:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
P0017:Fam193a UTSW 5 34440463 missense probably damaging 1.00
PIT4418001:Fam193a UTSW 5 34440535 missense probably damaging 0.97
R0172:Fam193a UTSW 5 34465613 missense probably damaging 0.97
R0413:Fam193a UTSW 5 34466208 missense possibly damaging 0.83
R0512:Fam193a UTSW 5 34426391 missense probably damaging 1.00
R0735:Fam193a UTSW 5 34439378 missense possibly damaging 0.85
R0764:Fam193a UTSW 5 34443341 missense probably damaging 0.99
R0904:Fam193a UTSW 5 34462143 missense probably damaging 1.00
R1756:Fam193a UTSW 5 34466292 missense possibly damaging 0.91
R1765:Fam193a UTSW 5 34436497 missense probably damaging 0.99
R1766:Fam193a UTSW 5 34462131 missense probably damaging 0.99
R1845:Fam193a UTSW 5 34443372 missense possibly damaging 0.91
R2051:Fam193a UTSW 5 34462150 missense probably benign 0.19
R2483:Fam193a UTSW 5 34465758 missense possibly damaging 0.96
R3014:Fam193a UTSW 5 34465672 missense probably benign 0.33
R4523:Fam193a UTSW 5 34443371 missense probably benign 0.07
R4723:Fam193a UTSW 5 34420786 missense probably benign 0.04
R4823:Fam193a UTSW 5 34459028 missense probably damaging 1.00
R4863:Fam193a UTSW 5 34466205 missense possibly damaging 0.86
R5331:Fam193a UTSW 5 34465571 splice site probably null
R5364:Fam193a UTSW 5 34466253 missense probably benign 0.01
R5564:Fam193a UTSW 5 34420855 missense probably damaging 0.98
R5580:Fam193a UTSW 5 34420788 missense probably benign 0.33
R5784:Fam193a UTSW 5 34466223 missense probably damaging 0.99
R5933:Fam193a UTSW 5 34465680 missense probably damaging 0.98
R5949:Fam193a UTSW 5 34440472 missense possibly damaging 0.82
R6106:Fam193a UTSW 5 34459030 missense possibly damaging 0.67
R6181:Fam193a UTSW 5 34443540 splice site probably null
R7095:Fam193a UTSW 5 34458034 missense probably damaging 0.99
R7109:Fam193a UTSW 5 34465821 missense possibly damaging 0.86
R7344:Fam193a UTSW 5 34485730 missense possibly damaging 0.71
R7401:Fam193a UTSW 5 34465635 missense possibly damaging 0.72
R7453:Fam193a UTSW 5 34464116 missense possibly damaging 0.72
R7456:Fam193a UTSW 5 34420788 missense possibly damaging 0.86
R7648:Fam193a UTSW 5 34431182 missense probably damaging 0.99
R7768:Fam193a UTSW 5 34465791 missense possibly damaging 0.85
R7783:Fam193a UTSW 5 34431180 missense probably damaging 0.99
R7818:Fam193a UTSW 5 34465653 missense possibly damaging 0.72
R7852:Fam193a UTSW 5 34410817 missense probably benign 0.01
R7853:Fam193a UTSW 5 34440129 missense probably benign 0.12
R7894:Fam193a UTSW 5 34440533 missense possibly damaging 0.92
R7933:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
R7957:Fam193a UTSW 5 34462086 missense probably damaging 1.00
R8191:Fam193a UTSW 5 34440573 missense probably damaging 0.96
R8281:Fam193a UTSW 5 34443436 missense unknown
Z1088:Fam193a UTSW 5 34420895 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTAGTTTCTTTCAGCAGGTGC -3'
(R):5'- ATACCAAAAGCCCCTGATGG -3'

Sequencing Primer
(F):5'- GTTCTGTTCAGAGTGTGTACATAATC -3'
(R):5'- GGAGCTCTGCAACTCAGACTGTAG -3'
Posted On2016-03-01