Incidental Mutation 'BB010:Fam193a'
ID 642575
Institutional Source Beutler Lab
Gene Symbol Fam193a
Ensembl Gene ENSMUSG00000037210
Gene Name family with sequence homology 193, member A
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.176) question?
Stock # BB010
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 34527277-34643800 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34623539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 23 (K23E)
Ref Sequence ENSEMBL: ENSMUSP00000137979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094867] [ENSMUST00000180376] [ENSMUST00000181379]
AlphaFold Q8CGI1
Predicted Effect possibly damaging
Transcript: ENSMUST00000094867
AA Change: K1090E

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092463
Gene: ENSMUSG00000037210
AA Change: K1090E

DomainStartEndE-ValueType
coiled coil region 113 141 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
low complexity region 347 368 N/A INTRINSIC
low complexity region 584 593 N/A INTRINSIC
low complexity region 608 643 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 763 785 N/A INTRINSIC
low complexity region 819 832 N/A INTRINSIC
coiled coil region 879 946 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1052 1063 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
Pfam:FAM193_C 1174 1230 3.5e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180376
AA Change: K1376E

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138082
Gene: ENSMUSG00000037210
AA Change: K1376E

DomainStartEndE-ValueType
SCOP:d1gvp__ 70 93 4e-3 SMART
coiled coil region 399 427 N/A INTRINSIC
low complexity region 544 556 N/A INTRINSIC
low complexity region 633 654 N/A INTRINSIC
low complexity region 870 879 N/A INTRINSIC
low complexity region 894 929 N/A INTRINSIC
low complexity region 962 977 N/A INTRINSIC
low complexity region 1049 1071 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1165 1232 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1338 1349 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000181379
AA Change: K23E

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137979
Gene: ENSMUSG00000037210
AA Change: K23E

DomainStartEndE-ValueType
low complexity region 88 99 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(19) : Gene trapped(19)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A G 11: 50,833,227 (GRCm39) V125A unknown Het
Adam34 T A 8: 44,103,911 (GRCm39) H578L probably damaging Het
Ago4 A T 4: 126,400,811 (GRCm39) M678K probably benign Het
Atosb A T 4: 43,035,919 (GRCm39) C271S probably benign Het
Atrn T C 2: 130,836,986 (GRCm39) L1150P probably damaging Het
Camta1 C T 4: 151,168,214 (GRCm39) E279K probably damaging Het
Ccdc88c T C 12: 100,911,749 (GRCm39) D695G possibly damaging Het
Col11a2 A T 17: 34,275,029 (GRCm39) K400* probably null Het
Cpsf4 T A 5: 145,104,168 (GRCm39) M1K probably null Het
Dnah12 A T 14: 26,488,072 (GRCm39) Q992L probably benign Het
Dnajc7 T C 11: 100,487,038 (GRCm39) Y145C probably damaging Het
Eml5 A T 12: 98,810,279 (GRCm39) D892E possibly damaging Het
Filip1 T G 9: 79,727,329 (GRCm39) K430T possibly damaging Het
Gm5089 T C 14: 122,673,403 (GRCm39) D106G unknown Het
Hip1 A T 5: 135,489,310 (GRCm39) N45K probably damaging Het
Hivep2 T C 10: 14,003,581 (GRCm39) S60P probably damaging Het
Ighv1-53 A T 12: 115,122,029 (GRCm39) C115* probably null Het
Macf1 T C 4: 123,303,444 (GRCm39) T353A probably benign Het
Mast3 A T 8: 71,239,279 (GRCm39) V433E probably damaging Het
Mast4 A T 13: 102,909,071 (GRCm39) M660K probably damaging Het
Nr2e1 T C 10: 42,439,379 (GRCm39) Y380C probably damaging Het
Or10g9b T C 9: 39,918,431 (GRCm39) probably benign Het
Or5b111 T A 19: 13,291,569 (GRCm39) M27L probably benign Het
Otog A G 7: 45,959,571 (GRCm39) D720G probably damaging Het
Slc6a1 T A 6: 114,288,859 (GRCm39) W473R probably damaging Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata31d1e A G 13: 59,891,565 (GRCm39) L85P probably damaging Het
Sprr3 T C 3: 92,364,515 (GRCm39) I110V possibly damaging Het
Ston1 A G 17: 88,943,572 (GRCm39) E326G probably benign Het
Tapbpl T G 6: 125,207,233 (GRCm39) Q152P probably damaging Het
Tectb C T 19: 55,183,105 (GRCm39) L319F possibly damaging Het
Tpp2 G A 1: 44,000,121 (GRCm39) G413D probably damaging Het
Tpsg1 A G 17: 25,592,178 (GRCm39) H84R probably damaging Het
Usp24 A G 4: 106,285,686 (GRCm39) N2437S probably benign Het
Usp32 T C 11: 84,897,885 (GRCm39) Q1152R probably damaging Het
Vmn2r6 T C 3: 64,467,224 (GRCm39) T92A probably benign Het
Xpo7 A G 14: 70,944,788 (GRCm39) V35A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zfp169 A G 13: 48,643,957 (GRCm39) V390A unknown Het
Other mutations in Fam193a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Fam193a APN 5 34,588,537 (GRCm39) missense probably damaging 0.99
IGL02111:Fam193a APN 5 34,568,001 (GRCm39) missense possibly damaging 0.72
IGL02139:Fam193a APN 5 34,602,081 (GRCm39) missense probably benign 0.12
IGL02218:Fam193a APN 5 34,600,932 (GRCm39) missense possibly damaging 0.68
BB020:Fam193a UTSW 5 34,623,539 (GRCm39) missense possibly damaging 0.53
P0017:Fam193a UTSW 5 34,597,807 (GRCm39) missense probably damaging 1.00
PIT4418001:Fam193a UTSW 5 34,597,879 (GRCm39) missense probably damaging 0.97
R0172:Fam193a UTSW 5 34,622,957 (GRCm39) missense probably damaging 0.97
R0413:Fam193a UTSW 5 34,623,552 (GRCm39) missense possibly damaging 0.83
R0512:Fam193a UTSW 5 34,583,735 (GRCm39) missense probably damaging 1.00
R0735:Fam193a UTSW 5 34,596,722 (GRCm39) missense possibly damaging 0.85
R0764:Fam193a UTSW 5 34,600,685 (GRCm39) missense probably damaging 0.99
R0904:Fam193a UTSW 5 34,619,487 (GRCm39) missense probably damaging 1.00
R1756:Fam193a UTSW 5 34,623,636 (GRCm39) missense possibly damaging 0.91
R1765:Fam193a UTSW 5 34,593,841 (GRCm39) missense probably damaging 0.99
R1766:Fam193a UTSW 5 34,619,475 (GRCm39) missense probably damaging 0.99
R1845:Fam193a UTSW 5 34,600,716 (GRCm39) missense possibly damaging 0.91
R2051:Fam193a UTSW 5 34,619,494 (GRCm39) missense probably benign 0.19
R2483:Fam193a UTSW 5 34,623,102 (GRCm39) missense possibly damaging 0.96
R3014:Fam193a UTSW 5 34,623,016 (GRCm39) missense probably benign 0.33
R4523:Fam193a UTSW 5 34,600,715 (GRCm39) missense probably benign 0.07
R4723:Fam193a UTSW 5 34,578,130 (GRCm39) missense probably benign 0.04
R4823:Fam193a UTSW 5 34,616,372 (GRCm39) missense probably damaging 1.00
R4826:Fam193a UTSW 5 34,593,875 (GRCm39) missense probably damaging 1.00
R4863:Fam193a UTSW 5 34,623,549 (GRCm39) missense possibly damaging 0.86
R5331:Fam193a UTSW 5 34,622,915 (GRCm39) splice site probably null
R5364:Fam193a UTSW 5 34,623,597 (GRCm39) missense probably benign 0.01
R5564:Fam193a UTSW 5 34,578,199 (GRCm39) missense probably damaging 0.98
R5580:Fam193a UTSW 5 34,578,132 (GRCm39) missense probably benign 0.33
R5784:Fam193a UTSW 5 34,623,567 (GRCm39) missense probably damaging 0.99
R5933:Fam193a UTSW 5 34,623,024 (GRCm39) missense probably damaging 0.98
R5949:Fam193a UTSW 5 34,597,816 (GRCm39) missense possibly damaging 0.82
R6106:Fam193a UTSW 5 34,616,374 (GRCm39) missense possibly damaging 0.67
R6181:Fam193a UTSW 5 34,600,884 (GRCm39) splice site probably null
R7095:Fam193a UTSW 5 34,615,378 (GRCm39) missense probably damaging 0.99
R7109:Fam193a UTSW 5 34,623,165 (GRCm39) missense possibly damaging 0.86
R7344:Fam193a UTSW 5 34,643,074 (GRCm39) missense possibly damaging 0.71
R7401:Fam193a UTSW 5 34,622,979 (GRCm39) missense possibly damaging 0.72
R7453:Fam193a UTSW 5 34,621,460 (GRCm39) missense possibly damaging 0.72
R7456:Fam193a UTSW 5 34,578,132 (GRCm39) missense possibly damaging 0.86
R7648:Fam193a UTSW 5 34,588,526 (GRCm39) missense probably damaging 0.99
R7768:Fam193a UTSW 5 34,623,135 (GRCm39) missense possibly damaging 0.85
R7783:Fam193a UTSW 5 34,588,524 (GRCm39) missense probably damaging 0.99
R7818:Fam193a UTSW 5 34,622,997 (GRCm39) missense possibly damaging 0.72
R7852:Fam193a UTSW 5 34,568,161 (GRCm39) missense probably benign 0.01
R7853:Fam193a UTSW 5 34,597,473 (GRCm39) missense probably benign 0.12
R7894:Fam193a UTSW 5 34,597,877 (GRCm39) missense possibly damaging 0.92
R7933:Fam193a UTSW 5 34,623,539 (GRCm39) missense possibly damaging 0.53
R7957:Fam193a UTSW 5 34,619,430 (GRCm39) missense probably damaging 1.00
R8191:Fam193a UTSW 5 34,597,917 (GRCm39) missense probably damaging 0.96
R8281:Fam193a UTSW 5 34,600,780 (GRCm39) missense unknown
R8554:Fam193a UTSW 5 34,633,115 (GRCm39) missense probably benign 0.05
R8743:Fam193a UTSW 5 34,577,501 (GRCm39) critical splice donor site probably null
R8821:Fam193a UTSW 5 34,616,374 (GRCm39) missense probably benign 0.01
R8831:Fam193a UTSW 5 34,616,374 (GRCm39) missense probably benign 0.01
R8896:Fam193a UTSW 5 34,583,828 (GRCm39) missense probably benign 0.03
R8943:Fam193a UTSW 5 34,597,796 (GRCm39) missense probably benign 0.01
R9026:Fam193a UTSW 5 34,616,536 (GRCm39) missense possibly damaging 0.91
R9182:Fam193a UTSW 5 34,623,361 (GRCm39) missense possibly damaging 0.72
R9210:Fam193a UTSW 5 34,597,481 (GRCm39) missense probably benign 0.01
R9212:Fam193a UTSW 5 34,597,481 (GRCm39) missense probably benign 0.01
R9291:Fam193a UTSW 5 34,593,835 (GRCm39) missense probably damaging 1.00
R9515:Fam193a UTSW 5 34,615,371 (GRCm39) missense possibly damaging 0.86
Z1088:Fam193a UTSW 5 34,578,239 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTACAGACCCTGTGGAC -3'
(R):5'- AGAATCAGCCTGCCATTCTGC -3'

Sequencing Primer
(F):5'- CTTCTGCTACCTAAGGAAGTCAATGG -3'
(R):5'- TGCCATTCTGCAGGAGCTG -3'
Posted On 2020-08-01