Incidental Mutation 'R4880:Polr1e'
ID375201
Institutional Source Beutler Lab
Gene Symbol Polr1e
Ensembl Gene ENSMUSG00000028318
Gene Namepolymerase (RNA) I polypeptide E
Synonyms53kDa, D030019D19Rik, Paf53, Praf1
MMRRC Submission 042489-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4880 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45018583-45036565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45022280 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 100 (C100S)
Ref Sequence ENSEMBL: ENSMUSP00000121007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029999] [ENSMUST00000107814] [ENSMUST00000133157]
Predicted Effect probably damaging
Transcript: ENSMUST00000029999
AA Change: C100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029999
Gene: ENSMUSG00000028318
AA Change: C100S

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 51 476 2.1e-98 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000054723
AA Change: C72S
SMART Domains Protein: ENSMUSP00000059941
Gene: ENSMUSG00000028318
AA Change: C72S

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 24 401 7.9e-104 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107814
AA Change: C100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103444
Gene: ENSMUSG00000028318
AA Change: C100S

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 49 385 4.1e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133157
AA Change: C100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121007
Gene: ENSMUSG00000028318
AA Change: C100S

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 49 431 1.4e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149284
Meta Mutation Damage Score 0.4706 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (89/91)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,612 E108G probably damaging Het
2610021A01Rik T C 7: 41,627,105 I744T possibly damaging Het
4931409K22Rik T C 5: 24,549,752 D340G probably benign Het
Adgrb1 T A 15: 74,587,022 F1324L possibly damaging Het
Adm A G 7: 110,629,119 H230R probably benign Het
Ank2 A T 3: 127,046,826 probably null Het
Arih1 A T 9: 59,436,885 F156L possibly damaging Het
Atf6b A G 17: 34,654,555 H660R probably damaging Het
Bcl9l C A 9: 44,508,710 Q1101K probably benign Het
Ccdc174 G A 6: 91,899,591 probably benign Het
Ccdc65 A C 15: 98,722,657 probably null Het
Cela2a T C 4: 141,822,287 N59S probably benign Het
Cfap157 A T 2: 32,778,249 V393E probably damaging Het
Chd1 T C 17: 17,374,654 F17S probably damaging Het
Cpne3 T C 4: 19,540,827 I183V probably benign Het
Cyp2d11 C A 15: 82,392,105 V122L probably benign Het
Dcaf8 C A 1: 172,187,489 probably benign Het
Dchs1 T A 7: 105,755,730 D2535V probably benign Het
Eif4a2 G T 16: 23,108,900 probably benign Het
Fzd4 T A 7: 89,407,901 D385E probably benign Het
Galnt13 C A 2: 55,060,572 Q422K probably damaging Het
Gm9745 A T 13: 8,940,666 probably null Het
Gnptab C T 10: 88,432,551 Q507* probably null Het
Hoxa7 A G 6: 52,217,034 probably benign Het
Htra1 T A 7: 130,962,083 V228D probably damaging Het
Ifi203 T A 1: 173,929,150 probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Itga2b G T 11: 102,457,722 probably benign Het
Itgb1 G T 8: 128,716,150 R272L probably damaging Het
Kif9 A G 9: 110,501,635 E343G probably damaging Het
Klhl5 T C 5: 65,158,901 V97A probably damaging Het
Lama5 C A 2: 180,177,068 probably benign Het
Lamb2 A G 9: 108,484,027 probably null Het
Lrp1b T A 2: 41,770,919 Y59F probably benign Het
Mmrn1 A G 6: 60,976,439 E568G probably benign Het
Mreg A G 1: 72,162,336 Y166H probably damaging Het
Myh7 C A 14: 54,978,588 V1323F probably benign Het
Nr1i3 T A 1: 171,216,382 I91K probably damaging Het
Nsfl1c T A 2: 151,506,310 D206E probably damaging Het
Olfr1294 A T 2: 111,537,353 L312* probably null Het
Olfr181 A C 16: 58,926,100 L157W probably damaging Het
Olfr273 A T 4: 52,856,411 M34K probably damaging Het
Olfr318 G A 11: 58,720,281 L256F probably benign Het
Olfr739 T C 14: 50,425,301 Y261H possibly damaging Het
Olfr921 T A 9: 38,775,547 C97* probably null Het
Pcdhb7 C T 18: 37,342,231 T140I probably benign Het
Pcdhgb5 T G 18: 37,732,588 S479A probably benign Het
Pcsk5 T A 19: 17,447,690 Y1583F probably damaging Het
Pias1 T C 9: 62,912,798 R296G probably benign Het
Rpap1 C A 2: 119,783,865 R17L probably damaging Het
Rtn1 C T 12: 72,217,458 V192I possibly damaging Het
Ryr2 G A 13: 11,752,218 P1262L probably damaging Het
Slc4a7 G T 14: 14,757,342 D396Y probably damaging Het
Slc5a8 T C 10: 88,892,024 Y118H probably damaging Het
Slc7a6os T A 8: 106,210,615 Q71L probably benign Het
Sphkap A G 1: 83,288,817 V127A probably damaging Het
Srpk1 A G 17: 28,591,225 S580P probably damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A G 3: 93,443,823 D190G possibly damaging Het
Tenm4 T A 7: 96,905,818 probably null Het
Tex14 T A 11: 87,486,295 I155N possibly damaging Het
Tm7sf3 A T 6: 146,609,860 V377E possibly damaging Het
Tnfsf9 T A 17: 57,105,433 M1K probably null Het
Tns2 C T 15: 102,112,039 T780I probably damaging Het
Trdn T A 10: 33,471,579 D639E probably benign Het
Trmt10a A G 3: 138,152,211 E173G possibly damaging Het
Ttn G A 2: 76,818,775 P10984S possibly damaging Het
Tubb6 C T 18: 67,401,316 T95M possibly damaging Het
Uroc1 G T 6: 90,357,537 R577L probably damaging Het
Vmn2r86 T A 10: 130,453,615 D137V probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp410 A G 12: 84,337,675 N355D probably damaging Het
Zfp59 C A 7: 27,844,317 D22E probably damaging Het
Zfp64 C T 2: 168,894,377 R460H probably damaging Het
Zfp655 T C 5: 145,244,358 V342A probably damaging Het
Zfp990 G A 4: 145,537,920 G496E probably benign Het
Other mutations in Polr1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Polr1e APN 4 45031364 unclassified probably benign
IGL01146:Polr1e APN 4 45031369 missense probably damaging 1.00
IGL01514:Polr1e APN 4 45018723 missense probably benign 0.00
IGL01533:Polr1e APN 4 45019328 missense probably damaging 1.00
R0207:Polr1e UTSW 4 45025143 splice site probably null
R0562:Polr1e UTSW 4 45029421 missense probably damaging 0.99
R0761:Polr1e UTSW 4 45027392 missense probably damaging 0.98
R1472:Polr1e UTSW 4 45028026 missense probably damaging 1.00
R1707:Polr1e UTSW 4 45027469 missense probably damaging 0.99
R2994:Polr1e UTSW 4 45027473 critical splice donor site probably null
R3054:Polr1e UTSW 4 45018724 missense possibly damaging 0.77
R4031:Polr1e UTSW 4 45018685 missense probably benign 0.02
R4195:Polr1e UTSW 4 45019327 missense probably damaging 1.00
R4771:Polr1e UTSW 4 45019282 missense probably damaging 1.00
R4806:Polr1e UTSW 4 45024482 missense probably benign
R4964:Polr1e UTSW 4 45029429 missense probably damaging 1.00
R4966:Polr1e UTSW 4 45029429 missense probably damaging 1.00
R5605:Polr1e UTSW 4 45018723 missense probably benign 0.00
R5934:Polr1e UTSW 4 45029369 missense probably damaging 0.99
R6358:Polr1e UTSW 4 45026813 missense probably damaging 1.00
R7241:Polr1e UTSW 4 45029340 missense probably damaging 1.00
R7436:Polr1e UTSW 4 45024553 splice site probably null
R8952:Polr1e UTSW 4 45018727 missense probably damaging 0.98
X0061:Polr1e UTSW 4 45029436 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTTCCAAAGGTTTCTGGCC -3'
(R):5'- AGAGGCAAGTCACCTTTTCCTC -3'

Sequencing Primer
(F):5'- CCAGAGACACCCTAGATATGATGTAG -3'
(R):5'- CTCCAGGGTTTCCACACCTG -3'
Posted On2016-03-17