Mutagenetix > Incidental Mutation

Incidental Mutation 'R7336:Chat'

580619

Institutional Source

Beutler Lab

Gene Symbol

Chat

Ensembl Gene

ENSMUSG00000021919

Gene Name

choline acetyltransferase

Synonyms

B230380D24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.889) question?

Stock #

R7336 (G1)

Quality Score

224.009

Status

Validated

Chromosome

Chromosomal Location

32408203-32465989 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 32423256 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000070865 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070125]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000070125

SMART Domains

Protein: ENSMUSP00000070865
Gene: ENSMUSG00000021919

Domain	Start	End	E-Value	Type
Pfam:Carn_acyltransf	24	612	5.5e-190	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the biosynthesis of the neurotransmitter acetylcholine. This gene product is a characteristic feature of cholinergic neurons, and changes in these neurons may explain some of the symptoms of Alzheimer's disease. Polymorphisms in this gene have been associated with Alzheimer's disease and mild cognitive impairment. Mutations in this gene are associated with congenital myasthenic syndrome associated with episodic apnea. Multiple transcript variants encoding different isoforms have been found for this gene, and some of these variants have been shown to encode more than one isoform. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutation of this gene results in hyperinnervation of motor neurons, abnormal morphology and patterning of neuromuscular synapses, and perinatal lethality. Mutant fetuses at E18.5 exhibit a hunched position, reduced body length, and carpoptosis(drop wrist). [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	T	7: 120,388,233	Q1247H	possibly damaging	Het
Acsf2	G	C	11: 94,571,650	Q180E	probably benign	Het
Adamts8	A	G	9: 30,962,067	D856G	probably benign	Het
Agrn	A	T	4: 156,174,914	C828*	probably null	Het
Ankub1	T	C	3: 57,665,687	T205A	probably benign	Het
Atm	A	T	9: 53,462,503	Y2150N	possibly damaging	Het
Barhl1	A	G	2: 28,909,843	F257L	probably benign	Het
Bcat2	T	A	7: 45,575,485	C27S	probably benign	Het
Bod1l	G	A	5: 41,821,524	R816C	probably damaging	Het
Btg3	A	G	16: 78,364,807	Y172H	probably benign	Het
C130079G13Rik	G	A	3: 59,932,753		probably null	Het
Cacna1d	T	C	14: 30,045,282	D1940G	probably benign	Het
Catsperg2	T	A	7: 29,706,601	N624I	possibly damaging	Het
Ccdc146	A	G	5: 21,303,112	V646A	probably benign	Het
Ccp110	C	T	7: 118,722,210	P363S	probably damaging	Het
Cct4	C	A	11: 23,001,564	T377K	possibly damaging	Het
Cep350	T	A	1: 155,862,276	H2607L	probably benign	Het
Cfap46	A	G	7: 139,620,104	F1954L	unknown	Het
Clasp2	A	G	9: 113,876,353		probably null	Het
Cldn9	T	C	17: 23,683,015	D212G	probably benign	Het
Cp	G	A	3: 19,964,532		probably null	Het
Cyfip1	T	A	7: 55,926,400	I1108N	possibly damaging	Het
Dnah14	A	G	1: 181,797,734	D4060G	probably damaging	Het
Dpyd	A	G	3: 119,064,921	T595A	probably damaging	Het
Eps8	G	A	6: 137,509,213	R434C	possibly damaging	Het
Fasl	A	G	1: 161,787,988	Y100H	probably damaging	Het
Fkbp9	A	T	6: 56,849,727	N104I	probably damaging	Het
Frmd4a	A	G	2: 4,473,214	T65A	possibly damaging	Het
Gm1110	T	C	9: 26,914,357	N102S	probably damaging	Het
Gm2381	T	C	7: 42,822,380	Q25R	possibly damaging	Het
Gtpbp2	A	G	17: 46,161,313	Y58C	probably damaging	Het
H2-T3	C	A	17: 36,187,345	K269N	probably damaging	Het
Icosl	C	A	10: 78,073,873	Y217*	probably null	Het
Il17rd	G	T	14: 27,087,546	R153L	probably benign	Het
Kif17	C	A	4: 138,298,306	T973K	possibly damaging	Het
Klk1b16	A	G	7: 44,141,483	I236M	probably benign	Het
Lgmn	G	A	12: 102,423,739		probably benign	Het
Lmbr1l	T	C	15: 98,913,587	D54G	possibly damaging	Het
Lrrc49	A	T	9: 60,677,191	I196N	possibly damaging	Het
Maml1	C	T	11: 50,266,449	A300T	possibly damaging	Het
Mapkap1	A	T	2: 34,533,817	Q293L	possibly damaging	Het
Mki67	T	C	7: 135,713,839	T69A	probably benign	Het
Mlph	G	A	1: 90,921,983		probably null	Het
Myh1	A	T	11: 67,220,609	M1625L	probably benign	Het
Myh3	G	T	11: 67,091,021	R781L	probably benign	Het
Nckap5	A	T	1: 126,026,049	I922K	probably benign	Het
Nlrp5	T	A	7: 23,417,634	M261K	probably damaging	Het
Olfr1317	A	T	2: 112,142,169	S75C	possibly damaging	Het
Olfr312	T	A	11: 58,831,924	Y257N	probably damaging	Het
Olfr396-ps1	G	A	11: 73,928,837	M204I	probably benign	Het
Olfr965	A	G	9: 39,719,610	N128D	probably benign	Het
Pak1	T	A	7: 97,888,972	V262E	probably benign	Het
Pigw	A	T	11: 84,877,104	D466E	probably damaging	Het
Pira2	A	T	7: 3,844,345	L115Q	probably damaging	Het
Rbm15	A	C	3: 107,333,116		probably benign	Het
Rfx1	A	G	8: 84,073,756		probably benign	Het
Rfx7	A	G	9: 72,593,357	Y133C	probably damaging	Het
Serpinb9d	T	A	13: 33,200,719	D226E	probably benign	Het
Sgk3	G	A	1: 9,884,476	A271T	possibly damaging	Het
Sh2d5	T	A	4: 138,256,839	C173S	probably benign	Het
Skint8	T	C	4: 111,939,572	V291A	probably benign	Het
Slc22a27	T	A	19: 7,926,689	N28Y	probably benign	Het
Slc25a54	G	A	3: 109,116,435	V449I	probably benign	Het
Slc39a9	T	C	12: 80,679,542	F255S	probably damaging	Het
Spata31d1c	C	T	13: 65,036,128	H495Y	probably damaging	Het
Stab2	G	A	10: 86,969,185	Q310*	probably null	Het
Supt16	C	A	14: 52,171,491	A809S	possibly damaging	Het
Tenm3	A	T	8: 48,236,177	M2125K	possibly damaging	Het
Tex2	G	A	11: 106,548,859	T565M	unknown	Het
Tll1	G	A	8: 64,025,142	A859V	probably damaging	Het
Tmem106c	C	T	15: 97,969,631	T232I	possibly damaging	Het
Tmem2	C	A	19: 21,826,145	Y847*	probably null	Het
Trim65	T	G	11: 116,128,290	D141A	probably benign	Het
Trim80	T	C	11: 115,441,216	F78S	probably damaging	Het
Txnrd1	T	A	10: 82,873,217	I83N	probably benign	Het
Vnn3	G	A	10: 23,851,908	G72D	probably benign	Het
Wasl	G	T	6: 24,619,687	P278Q	unknown	Het
Wdr62	A	T	7: 30,243,917	L951Q	probably damaging	Het
Zfp760	C	T	17: 21,723,833	T663I	unknown	Het

Other mutations in Chat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Chat	APN	14	32449023	missense	probably damaging	0.98
IGL01618:Chat	APN	14	32446892	splice site	probably null
IGL02192:Chat	APN	14	32423322	missense	possibly damaging	0.94
IGL02418:Chat	APN	14	32446949	missense	possibly damaging	0.74
IGL02851:Chat	APN	14	32458613	missense	probably benign
IGL02966:Chat	APN	14	32448946	missense	probably damaging	1.00
IGL03401:Chat	APN	14	32452569	missense	probably damaging	1.00
R0511:Chat	UTSW	14	32409019	missense	probably damaging	1.00
R1462:Chat	UTSW	14	32420778	missense	probably damaging	1.00
R1462:Chat	UTSW	14	32420778	missense	probably damaging	1.00
R1729:Chat	UTSW	14	32446795	missense	probably damaging	1.00
R1782:Chat	UTSW	14	32408987	missense	probably damaging	1.00
R1972:Chat	UTSW	14	32424191	missense	probably benign	0.03
R1973:Chat	UTSW	14	32424191	missense	probably benign	0.03
R2061:Chat	UTSW	14	32446873	missense	probably benign	0.00
R2270:Chat	UTSW	14	32454581	missense	probably damaging	0.99
R4012:Chat	UTSW	14	32423312	missense	possibly damaging	0.56
R4601:Chat	UTSW	14	32424155	missense	probably benign	0.00
R4620:Chat	UTSW	14	32453818	missense	probably damaging	1.00
R4760:Chat	UTSW	14	32453737	missense	probably benign
R4885:Chat	UTSW	14	32454610	missense	probably damaging	1.00
R4899:Chat	UTSW	14	32448977	missense	possibly damaging	0.80
R4940:Chat	UTSW	14	32419105	missense	probably damaging	1.00
R4960:Chat	UTSW	14	32420814	missense	possibly damaging	0.86
R5094:Chat	UTSW	14	32408939	missense	probably damaging	1.00
R6039:Chat	UTSW	14	32449027	missense	probably damaging	1.00
R6039:Chat	UTSW	14	32449027	missense	probably damaging	1.00
R6621:Chat	UTSW	14	32419013	missense	probably damaging	0.97
R6648:Chat	UTSW	14	32454694	missense	probably benign	0.17
R6980:Chat	UTSW	14	32424154	missense	probably benign	0.15
R7203:Chat	UTSW	14	32419057	missense	probably damaging	1.00
R7530:Chat	UTSW	14	32408958	nonsense	probably null
R8782:Chat	UTSW	14	32424198	missense	probably benign	0.00
R8941:Chat	UTSW	14	32409006	missense	probably benign	0.43
R9496:Chat	UTSW	14	32426162	missense	probably benign	0.00
R9560:Chat	UTSW	14	32448985	nonsense	probably null
X0014:Chat	UTSW	14	32446933	missense	probably benign	0.01
X0066:Chat	UTSW	14	32453831	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACATTCGAGCAAGGTTATTTCC -3'
(R):5'- AAATTTCAGGGGCTGTGCAC -3'

Sequencing Primer
(F):5'- CGAGCAAGGTTATTTCCTGAGAACC -3'
(R):5'- CTTGCACAGGAAAGCTGTGCTG -3'

Posted On

2019-10-14