Incidental Mutation 'R4888:Kmt2a'
ID377109
Institutional Source Beutler Lab
Gene Symbol Kmt2a
Ensembl Gene ENSMUSG00000002028
Gene Namelysine (K)-specific methyltransferase 2A
SynonymsMll1, HTRX1, ALL-1, Cxxc7, trithorax Drosophila, Mll, All1
MMRRC Submission 042493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4888 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44803355-44881296 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 44821680 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000002095] [ENSMUST00000114689]
Predicted Effect unknown
Transcript: ENSMUST00000002095
AA Change: P2444T
SMART Domains Protein: ENSMUSP00000002095
Gene: ENSMUSG00000002028
AA Change: P2444T

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1624 7.94e-8 SMART
BROMO 1632 1766 2.24e-10 SMART
low complexity region 1816 1850 N/A INTRINSIC
PHD 1931 1977 1.74e-4 SMART
low complexity region 1990 2001 N/A INTRINSIC
FYRN 2029 2072 2.33e-20 SMART
low complexity region 2180 2194 N/A INTRINSIC
low complexity region 2215 2227 N/A INTRINSIC
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2789 2800 N/A INTRINSIC
low complexity region 2824 2833 N/A INTRINSIC
low complexity region 2856 2878 N/A INTRINSIC
low complexity region 2902 2909 N/A INTRINSIC
low complexity region 3115 3141 N/A INTRINSIC
low complexity region 3164 3175 N/A INTRINSIC
low complexity region 3228 3239 N/A INTRINSIC
low complexity region 3299 3312 N/A INTRINSIC
low complexity region 3342 3351 N/A INTRINSIC
low complexity region 3405 3419 N/A INTRINSIC
low complexity region 3498 3526 N/A INTRINSIC
low complexity region 3620 3633 N/A INTRINSIC
FYRC 3662 3747 8.54e-37 SMART
SET 3823 3945 6.09e-45 SMART
PostSET 3947 3963 1.65e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114689
AA Change: P2447T
SMART Domains Protein: ENSMUSP00000110337
Gene: ENSMUSG00000002028
AA Change: P2447T

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1627 9.12e-8 SMART
BROMO 1635 1769 2.24e-10 SMART
low complexity region 1819 1853 N/A INTRINSIC
PHD 1934 1980 1.74e-4 SMART
low complexity region 1993 2004 N/A INTRINSIC
FYRN 2032 2075 2.33e-20 SMART
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2218 2230 N/A INTRINSIC
low complexity region 2610 2621 N/A INTRINSIC
low complexity region 2792 2803 N/A INTRINSIC
low complexity region 2827 2836 N/A INTRINSIC
low complexity region 2859 2881 N/A INTRINSIC
low complexity region 2905 2912 N/A INTRINSIC
low complexity region 3118 3144 N/A INTRINSIC
low complexity region 3167 3178 N/A INTRINSIC
low complexity region 3231 3242 N/A INTRINSIC
low complexity region 3302 3315 N/A INTRINSIC
low complexity region 3345 3354 N/A INTRINSIC
low complexity region 3408 3422 N/A INTRINSIC
low complexity region 3501 3529 N/A INTRINSIC
low complexity region 3623 3636 N/A INTRINSIC
FYRC 3665 3750 8.54e-37 SMART
SET 3826 3948 6.09e-45 SMART
PostSET 3950 3966 1.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138119
Predicted Effect probably benign
Transcript: ENSMUST00000152241
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (150/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-14.5 with edematous bodies, petechiae, and hematopoietic insufficiency. Heterozygotes show reduced growth, hematopoietic abnormalities, and homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931403M11Rik C A 14: 24,621,351 noncoding transcript Het
4931408C20Rik A G 1: 26,683,547 Y851H probably benign Het
Abca7 A G 10: 80,002,728 K612R probably damaging Het
Adamtsl3 T C 7: 82,574,614 V275A possibly damaging Het
Afg3l1 G A 8: 123,488,326 probably null Het
Alcam T A 16: 52,268,813 H508L probably benign Het
Ankrd45 G A 1: 161,155,372 R151H probably damaging Het
Aqr G A 2: 114,150,509 L264F probably damaging Het
Arfgef2 G A 2: 166,835,613 A53T probably damaging Het
Arhgap30 A G 1: 171,409,312 T1085A probably benign Het
Atp10a T C 7: 58,785,307 V314A probably damaging Het
Bdp1 T C 13: 100,051,119 D1580G probably benign Het
Btbd17 T A 11: 114,794,091 T41S possibly damaging Het
Cacna1c T C 6: 118,751,439 N378S probably damaging Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Ccar1 A G 10: 62,753,218 S829P unknown Het
Ccdc180 T C 4: 45,909,308 L492P probably damaging Het
Ccser2 A T 14: 36,940,386 N280K probably damaging Het
Cd37 T C 7: 45,233,935 D271G probably damaging Het
Cdcp1 G A 9: 123,182,129 probably benign Het
Cep85 T A 4: 134,164,751 probably benign Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Csmd1 A G 8: 15,895,674 probably benign Het
Cytl1 G T 5: 37,735,574 L9F unknown Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Degs1 G A 1: 182,276,805 T305I probably damaging Het
Dnttip2 T G 3: 122,276,592 C485W probably damaging Het
Ecel1 G A 1: 87,148,727 probably benign Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Elmo2 A T 2: 165,295,289 C562S probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
F2r A C 13: 95,604,397 V210G probably damaging Het
Fam171a1 T A 2: 3,223,509 V179E probably damaging Het
Fmod G T 1: 134,040,239 V6F possibly damaging Het
Foxr2 A G X: 153,130,316 Q61R probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gck A T 11: 5,909,150 M139K possibly damaging Het
Gif A G 19: 11,752,219 T181A probably benign Het
Gm10192 C G 4: 97,183,108 S20T probably null Het
Gm13088 A G 4: 143,654,401 S351P probably benign Het
Gm44501 T C 17: 40,576,624 L11P unknown Het
Gm572 T C 4: 148,666,845 probably null Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Gnas A G 2: 174,298,089 K17R possibly damaging Het
Grm2 T A 9: 106,650,666 S340C probably damaging Het
Gsc T A 12: 104,472,015 H198L probably damaging Het
H2-Q3 A T 17: 35,359,448 noncoding transcript Het
Hist1h4a T C 13: 23,760,952 D69G probably damaging Het
Hivep3 A G 4: 120,122,934 E1723G probably damaging Het
Hk3 A T 13: 55,006,592 L757Q probably damaging Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Ier3ip1 T A 18: 76,939,531 probably benign Het
Itch T A 2: 155,217,977 probably null Het
Kalrn T A 16: 34,171,330 Q974L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Klhl9 T C 4: 88,721,945 K20E probably benign Het
Krt17 C A 11: 100,256,479 V409L probably benign Het
Lmx1b T C 2: 33,564,790 N322S probably benign Het
Lrrc63 G C 14: 75,125,966 P242A probably benign Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Map3k19 T A 1: 127,817,733 E1328V probably damaging Het
Map4k2 C T 19: 6,344,003 A280V probably benign Het
Mettl11b A T 1: 163,703,064 C269S probably benign Het
Micall1 C T 15: 79,131,848 R802* probably null Het
Mmp14 A G 14: 54,436,205 R109G probably damaging Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mpeg1 A G 19: 12,463,070 T631A probably damaging Het
Mpnd A G 17: 56,011,641 M217V probably benign Het
Mrc2 T C 11: 105,341,208 V862A probably damaging Het
Mug2 T A 6: 122,081,195 S1239T probably damaging Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo18b A T 5: 112,874,480 probably benign Het
Myo1c C A 11: 75,669,227 T703N probably damaging Het
Myt1l T G 12: 29,886,139 C909G unknown Het
Nbea T C 3: 56,005,355 S1004G possibly damaging Het
Neb T C 2: 52,296,307 N918D probably benign Het
Nrtn T C 17: 56,751,636 T122A probably damaging Het
Nsd3 A T 8: 25,698,911 S1042C probably damaging Het
Nvl A G 1: 181,117,626 L461S probably damaging Het
Olfr1339 A C 4: 118,734,688 H53P probably benign Het
Olfr1346 A T 7: 6,474,613 I168F probably damaging Het
Olfr1425 C G 19: 12,074,315 G106R probably damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr786 A C 10: 129,437,379 D189A possibly damaging Het
Olfr90 G A 17: 37,085,451 T238I probably damaging Het
Onecut2 A T 18: 64,340,927 H183L possibly damaging Het
Pcdhb21 G T 18: 37,515,077 V420F possibly damaging Het
Pcdhb9 G A 18: 37,403,233 G760D probably benign Het
Pglyrp2 G A 17: 32,418,797 P86S probably benign Het
Phyhip T A 14: 70,467,325 V328E probably damaging Het
Pitpnb A T 5: 111,382,996 K218N possibly damaging Het
Pitrm1 A G 13: 6,578,560 D963G probably damaging Het
Pmfbp1 A G 8: 109,532,160 Y699C probably damaging Het
Pmpcb T A 5: 21,740,662 probably benign Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Prss41 A T 17: 23,837,003 M252K probably benign Het
Prss46 A T 9: 110,844,550 M1L possibly damaging Het
Rimklb T C 6: 122,464,092 probably null Het
Rngtt T C 4: 33,500,335 I556T unknown Het
Rock1 A C 18: 10,122,698 D374E probably benign Het
Rspry1 C A 8: 94,658,789 H450N probably benign Het
Rusc2 T C 4: 43,423,942 V1032A probably damaging Het
Sacs A G 14: 61,212,198 R3898G probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Sipa1l1 C A 12: 82,342,333 S444R probably damaging Het
Sntg1 T A 1: 8,363,594 I478F probably damaging Het
Sptb G T 12: 76,609,037 L1424M probably benign Het
Sry T A Y: 2,663,105 H185L unknown Het
Stox2 T G 8: 47,203,163 T93P probably damaging Het
Tatdn2 T A 6: 113,704,605 F472Y possibly damaging Het
Tefm A T 11: 80,140,359 V17D possibly damaging Het
Tekt2 G T 4: 126,324,667 T70N probably benign Het
Ticam1 T C 17: 56,271,642 D151G probably damaging Het
Tmem2 T C 19: 21,856,164 V1322A probably benign Het
Tmem63c A G 12: 87,089,365 E785G probably damaging Het
Tnmd A T X: 133,864,802 N219I probably benign Het
Ttc14 T A 3: 33,806,875 L407* probably null Het
Ttll7 T C 3: 146,894,177 M1T probably null Het
Ttn T A 2: 76,916,491 probably null Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Uggt2 T C 14: 119,049,253 T224A probably damaging Het
Uggt2 A T 14: 119,077,650 probably null Het
Umodl1 A G 17: 30,999,201 E1254G probably damaging Het
Unc5d A G 8: 28,666,899 F773L probably benign Het
Unc80 C A 1: 66,644,447 P2216Q probably damaging Het
Usp40 T A 1: 87,986,201 probably null Het
Vmn1r117 A T 7: 20,883,496 M209K probably damaging Het
Vmn2r44 A T 7: 8,377,986 W303R probably benign Het
Wnk2 G A 13: 49,071,002 R268C probably damaging Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Xkr6 T C 14: 63,819,504 V288A unknown Het
Zfp125 A G 12: 20,900,458 noncoding transcript Het
Zfp512b A C 2: 181,587,063 V703G probably damaging Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zgpat T C 2: 181,378,858 S275P probably benign Het
Other mutations in Kmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kmt2a APN 9 44807934 unclassified probably benign
IGL00667:Kmt2a APN 9 44824386 utr 3 prime probably benign
IGL00828:Kmt2a APN 9 44820776 unclassified probably benign
IGL01080:Kmt2a APN 9 44809092 missense unknown
IGL01131:Kmt2a APN 9 44821170 unclassified probably benign
IGL01294:Kmt2a APN 9 44820297 unclassified probably benign
IGL01432:Kmt2a APN 9 44809096 missense unknown
IGL01646:Kmt2a APN 9 44825484 utr 3 prime probably benign
IGL01777:Kmt2a APN 9 44849005 missense probably damaging 0.99
IGL01944:Kmt2a APN 9 44849767 missense probably damaging 1.00
IGL02125:Kmt2a APN 9 44848686 missense probably damaging 1.00
IGL02207:Kmt2a APN 9 44847682 missense probably damaging 0.98
IGL02424:Kmt2a APN 9 44824635 utr 3 prime probably benign
IGL02499:Kmt2a APN 9 44830509 splice site probably benign
IGL02574:Kmt2a APN 9 44830513 splice site probably benign
IGL02711:Kmt2a APN 9 44824523 splice site probably benign
IGL02828:Kmt2a APN 9 44821947 unclassified probably benign
IGL03012:Kmt2a APN 9 44810966 unclassified probably benign
IGL03242:Kmt2a APN 9 44848392 missense probably damaging 0.99
IGL03294:Kmt2a APN 9 44820565 unclassified probably benign
IGL03326:Kmt2a APN 9 44818747 nonsense probably null
Chromas UTSW 9 44820342 unclassified probably benign
Heteros UTSW 9 44828811 nonsense probably null
Pyknos UTSW 9 44826828 utr 3 prime probably benign
Skies UTSW 9 44829261 utr 3 prime probably benign
spacious UTSW 9 44847645 missense probably benign 0.03
PIT4402001:Kmt2a UTSW 9 44841062 missense unknown
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0180:Kmt2a UTSW 9 44826851 utr 3 prime probably benign
R0363:Kmt2a UTSW 9 44809713 critical splice donor site probably null
R0411:Kmt2a UTSW 9 44819964 unclassified probably benign
R0555:Kmt2a UTSW 9 44847571 missense probably damaging 1.00
R0587:Kmt2a UTSW 9 44847534 missense probably damaging 0.99
R0865:Kmt2a UTSW 9 44818770 unclassified probably benign
R0988:Kmt2a UTSW 9 44848549 missense probably benign 0.03
R1006:Kmt2a UTSW 9 44847696 missense probably damaging 0.99
R1108:Kmt2a UTSW 9 44849062 missense probably damaging 1.00
R1292:Kmt2a UTSW 9 44814694 utr 3 prime probably benign
R1322:Kmt2a UTSW 9 44821121 unclassified probably benign
R1476:Kmt2a UTSW 9 44824635 utr 3 prime probably benign
R1485:Kmt2a UTSW 9 44826928 utr 3 prime probably benign
R1487:Kmt2a UTSW 9 44833990 utr 3 prime probably benign
R1493:Kmt2a UTSW 9 44846905 missense probably damaging 1.00
R1499:Kmt2a UTSW 9 44848266 missense probably benign 0.36
R1507:Kmt2a UTSW 9 44818403 unclassified probably benign
R1603:Kmt2a UTSW 9 44841561 unclassified probably null
R1635:Kmt2a UTSW 9 44824369 utr 3 prime probably benign
R1662:Kmt2a UTSW 9 44836670 utr 3 prime probably benign
R1711:Kmt2a UTSW 9 44841621 missense unknown
R1785:Kmt2a UTSW 9 44819675 unclassified probably benign
R1786:Kmt2a UTSW 9 44819675 unclassified probably benign
R1919:Kmt2a UTSW 9 44820345 unclassified probably benign
R1964:Kmt2a UTSW 9 44820644 missense probably benign 0.23
R1965:Kmt2a UTSW 9 44821460 unclassified probably benign
R2029:Kmt2a UTSW 9 44818450 missense probably benign 0.23
R2054:Kmt2a UTSW 9 44823374 utr 3 prime probably benign
R2259:Kmt2a UTSW 9 44881142 unclassified probably benign
R2382:Kmt2a UTSW 9 44820910 unclassified probably benign
R2483:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3033:Kmt2a UTSW 9 44821863 unclassified probably benign
R3423:Kmt2a UTSW 9 44820097 unclassified probably benign
R3428:Kmt2a UTSW 9 44848119 missense probably benign 0.06
R3605:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3607:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3611:Kmt2a UTSW 9 44822466 unclassified probably benign
R3623:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3745:Kmt2a UTSW 9 44831340 utr 3 prime probably benign
R3806:Kmt2a UTSW 9 44820356 unclassified probably benign
R3841:Kmt2a UTSW 9 44831291 utr 3 prime probably benign
R3855:Kmt2a UTSW 9 44830499 utr 3 prime probably benign
R4027:Kmt2a UTSW 9 44836693 utr 3 prime probably benign
R4124:Kmt2a UTSW 9 44819796 unclassified probably benign
R4177:Kmt2a UTSW 9 44820983 unclassified probably benign
R4296:Kmt2a UTSW 9 44821175 unclassified probably benign
R4414:Kmt2a UTSW 9 44809780 unclassified probably benign
R4461:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R4668:Kmt2a UTSW 9 44824572 utr 3 prime probably benign
R4761:Kmt2a UTSW 9 44849124 missense probably damaging 1.00
R4812:Kmt2a UTSW 9 44831354 utr 3 prime probably benign
R4815:Kmt2a UTSW 9 44821256 unclassified probably benign
R4817:Kmt2a UTSW 9 44821466 unclassified probably benign
R4958:Kmt2a UTSW 9 44848467 missense probably damaging 1.00
R5055:Kmt2a UTSW 9 44818352 unclassified probably benign
R5065:Kmt2a UTSW 9 44842700 unclassified probably benign
R5185:Kmt2a UTSW 9 44820246 unclassified probably benign
R5358:Kmt2a UTSW 9 44819274 unclassified probably benign
R5411:Kmt2a UTSW 9 44848485 missense probably damaging 1.00
R5420:Kmt2a UTSW 9 44848336 missense probably damaging 1.00
R5483:Kmt2a UTSW 9 44824624 utr 3 prime probably benign
R5487:Kmt2a UTSW 9 44821975 unclassified probably benign
R5488:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5489:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5538:Kmt2a UTSW 9 44820342 unclassified probably benign
R5576:Kmt2a UTSW 9 44842634 missense possibly damaging 0.94
R5631:Kmt2a UTSW 9 44820688 unclassified probably benign
R5781:Kmt2a UTSW 9 44847842 nonsense probably null
R5789:Kmt2a UTSW 9 44819904 unclassified probably benign
R5932:Kmt2a UTSW 9 44820647 unclassified probably benign
R6027:Kmt2a UTSW 9 44819290 unclassified probably benign
R6191:Kmt2a UTSW 9 44826828 utr 3 prime probably benign
R6239:Kmt2a UTSW 9 44819796 unclassified probably benign
R6291:Kmt2a UTSW 9 44832874 utr 3 prime probably benign
R6344:Kmt2a UTSW 9 44821859 unclassified probably benign
R6611:Kmt2a UTSW 9 44849272 missense probably damaging 0.98
R6641:Kmt2a UTSW 9 44819835 unclassified probably benign
R6651:Kmt2a UTSW 9 44828811 nonsense probably null
R6825:Kmt2a UTSW 9 44818407 unclassified probably benign
R6853:Kmt2a UTSW 9 44818407 unclassified probably benign
R6897:Kmt2a UTSW 9 44847645 missense probably benign 0.03
R6930:Kmt2a UTSW 9 44842665 unclassified probably benign
R6932:Kmt2a UTSW 9 44829261 utr 3 prime probably benign
R6957:Kmt2a UTSW 9 44820022 unclassified probably benign
R7170:Kmt2a UTSW 9 44810721 missense unknown
R7202:Kmt2a UTSW 9 44847715 missense probably benign 0.03
R7481:Kmt2a UTSW 9 44809071 missense unknown
R7538:Kmt2a UTSW 9 44847744 missense probably damaging 0.99
R7597:Kmt2a UTSW 9 44831353 missense unknown
X0021:Kmt2a UTSW 9 44831235 utr 3 prime probably benign
X0025:Kmt2a UTSW 9 44825392 nonsense probably null
X0026:Kmt2a UTSW 9 44820906 unclassified probably benign
X0027:Kmt2a UTSW 9 44880896 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTCACTTTGACCGAGCACTTC -3'
(R):5'- AGCCCTCTCCAAATGAAGATG -3'

Sequencing Primer
(F):5'- GTGCCTGTAACTCCTTGGAAGATC -3'
(R):5'- CCTCTCCAAATGAAGATGGTGAAATC -3'
Posted On2016-03-17