Incidental Mutation 'R6552:Vmn1r80'
ID521693
Institutional Source Beutler Lab
Gene Symbol Vmn1r80
Ensembl Gene ENSMUSG00000115744
Gene Namevomeronasal 1 receptor 80
SynonymsV1rg3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R6552 (G1)
Quality Score202.009
Status Not validated
Chromosome7
Chromosomal Location12189286-12203313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12193757 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 265 (L265F)
Ref Sequence ENSEMBL: ENSMUSP00000153967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075053] [ENSMUST00000227205] [ENSMUST00000227471] [ENSMUST00000227755] [ENSMUST00000228028] [ENSMUST00000228578]
Predicted Effect probably damaging
Transcript: ENSMUST00000075053
AA Change: L265F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074564
Gene: ENSMUSG00000115744
AA Change: L265F

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 5.4e-11 PFAM
Pfam:7tm_1 23 290 5.3e-7 PFAM
Pfam:V1R 31 298 3e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227205
AA Change: L265F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227240
Predicted Effect probably benign
Transcript: ENSMUST00000227471
Predicted Effect probably damaging
Transcript: ENSMUST00000227755
AA Change: L265F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000228028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228563
Predicted Effect probably damaging
Transcript: ENSMUST00000228578
AA Change: L265F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang5 A T 14: 43,962,797 H106L probably benign Het
Arsk A G 13: 76,072,196 Y260H probably damaging Het
Atxn2l C T 7: 126,493,821 V833M possibly damaging Het
Bpifa6 G A 2: 153,987,158 D202N probably damaging Het
Ccdc103 A G 11: 102,884,144 S190G probably benign Het
Col6a6 C T 9: 105,698,913 V2083I probably damaging Het
Creb5 A G 6: 53,685,384 D222G probably damaging Het
Cyp7a1 C T 4: 6,272,361 W284* probably null Het
Dnmt3a T C 12: 3,907,623 V868A probably damaging Het
Efr3a A G 15: 65,857,490 D680G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l4a A G 18: 33,878,979 Y163H probably damaging Het
Gabra1 A T 11: 42,147,099 S231T probably damaging Het
Golga4 T A 9: 118,514,231 F42I probably damaging Het
Greb1l G A 18: 10,541,814 S1187N probably benign Het
Haspin A G 11: 73,137,564 V233A probably benign Het
Il34 T A 8: 110,742,427 K187I probably benign Het
Kcnn2 A G 18: 45,560,098 H247R probably benign Het
Klf5 T C 14: 99,301,642 S84P probably benign Het
Lama5 G T 2: 180,181,154 P2773Q probably damaging Het
Lcat T C 8: 105,939,679 M404V possibly damaging Het
Lrp6 A T 6: 134,454,729 S1473T probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mn1 T C 5: 111,420,887 S908P possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr695 TGAAGCC T 7: 106,714,643 probably benign Het
Pcdhb2 A T 18: 37,295,993 M340L probably benign Het
Pex1 G A 5: 3,623,953 E748K probably damaging Het
Qrich1 T C 9: 108,534,305 V343A possibly damaging Het
Rho A G 6: 115,931,748 probably null Het
Sdhaf4 C A 1: 24,005,606 probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Siae T C 9: 37,646,400 V501A possibly damaging Het
Skint3 T C 4: 112,290,285 Y402H possibly damaging Het
Skint6 A C 4: 113,067,490 V515G possibly damaging Het
Slc23a1 C A 18: 35,622,338 G475C probably damaging Het
Smad9 A G 3: 54,782,746 Y129C probably damaging Het
Snw1 A G 12: 87,459,419 probably null Het
Spice1 A G 16: 44,379,033 D616G possibly damaging Het
Stam2 T C 2: 52,708,227 probably null Het
Sumo3 G T 10: 77,606,257 probably benign Het
Syne2 T G 12: 75,890,241 N204K possibly damaging Het
Tmem200a T C 10: 25,993,483 N296S probably damaging Het
Ttbk1 G T 17: 46,478,962 T125N probably benign Het
Ubr2 G T 17: 46,966,268 probably null Het
Vwa8 A T 14: 79,198,222 T1791S possibly damaging Het
Other mutations in Vmn1r80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Vmn1r80 APN 7 12193380 missense possibly damaging 0.69
IGL01652:Vmn1r80 APN 7 12193136 missense probably benign 0.19
IGL02102:Vmn1r80 APN 7 12193691 missense probably damaging 1.00
IGL02165:Vmn1r80 APN 7 12193452 missense probably benign 0.31
IGL02328:Vmn1r80 APN 7 12193478 missense probably benign 0.12
IGL02336:Vmn1r80 APN 7 12193254 missense probably benign 0.23
IGL02606:Vmn1r80 APN 7 12193032 missense probably damaging 1.00
R0310:Vmn1r80 UTSW 7 12193848 missense probably benign 0.00
R0399:Vmn1r80 UTSW 7 12193317 missense possibly damaging 0.88
R1983:Vmn1r80 UTSW 7 12193661 missense probably benign 0.01
R2079:Vmn1r80 UTSW 7 12193194 missense probably damaging 1.00
R4278:Vmn1r80 UTSW 7 12193527 missense probably benign 0.00
R4501:Vmn1r80 UTSW 7 12193391 missense probably benign 0.39
R5894:Vmn1r80 UTSW 7 12193727 missense probably damaging 0.99
R5991:Vmn1r80 UTSW 7 12193496 missense probably benign 0.09
R7560:Vmn1r80 UTSW 7 12193823 missense probably damaging 0.98
R7659:Vmn1r80 UTSW 7 12193050 missense probably damaging 1.00
R8313:Vmn1r80 UTSW 7 12193067 missense probably benign 0.00
Z1189:Vmn1r80 UTSW 7 12193433 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTGAGTATGCTCTACAGACATAAG -3'
(R):5'- GAATGCTGTGTTAACATTGCAC -3'

Sequencing Primer
(F):5'- TGCTCTACAGACATAAGAAACAAGTC -3'
(R):5'- GACAGACAATGAGGTCTCA -3'
Posted On2018-06-06