Incidental Mutation 'R4977:Clcn4'
ID 382754
Institutional Source Beutler Lab
Gene Symbol Clcn4
Ensembl Gene ENSMUSG00000000605
Gene Name chloride channel, voltage-sensitive 4
Synonyms Clc4-2, Clcn4-2
MMRRC Submission 042572-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4977 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 7285308-7303837 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7294436 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 411 (I411F)
Ref Sequence ENSEMBL: ENSMUSP00000148174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000619] [ENSMUST00000209916] [ENSMUST00000210061] [ENSMUST00000210362] [ENSMUST00000210594] [ENSMUST00000211574]
AlphaFold Q61418
Predicted Effect probably benign
Transcript: ENSMUST00000000619
AA Change: I442F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000619
Gene: ENSMUSG00000000605
AA Change: I442F

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Voltage_CLC 149 552 2.7e-111 PFAM
CBS 596 646 1.07e-1 SMART
CBS 687 734 4.92e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209916
Predicted Effect probably benign
Transcript: ENSMUST00000210061
AA Change: I411F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210318
Predicted Effect probably benign
Transcript: ENSMUST00000210362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210444
Predicted Effect probably benign
Transcript: ENSMUST00000210594
AA Change: I382F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211551
Predicted Effect probably benign
Transcript: ENSMUST00000211574
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. Chloride channel 4 has an evolutionary conserved CpG island and is conserved in both mouse and hamster. This gene is mapped in close proximity to APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), which are both located on the human X chromosome at band p22.3. The physiological role of chloride channel 4 remains unknown but may contribute to the pathogenesis of neuronal disorders. Alternate splicing results in two transcript variants that encode different proteins. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,026,899 (GRCm39) D910G probably benign Het
Amy1 C T 3: 113,363,026 (GRCm39) probably null Het
C1s2 A G 6: 124,612,598 (GRCm39) M19T probably damaging Het
Cadps2 A G 6: 23,599,478 (GRCm39) I276T probably damaging Het
Cdyl2 A G 8: 117,302,008 (GRCm39) C458R probably damaging Het
Cep112 T C 11: 108,325,062 (GRCm39) S35P probably damaging Het
Chd9 T C 8: 91,760,336 (GRCm39) L2027P possibly damaging Het
Cyp3a57 T C 5: 145,286,236 (GRCm39) probably null Het
Dis3l A C 9: 64,214,483 (GRCm39) S919A probably benign Het
Dnah8 A G 17: 30,882,275 (GRCm39) T616A probably benign Het
Emx2 A G 19: 59,447,678 (GRCm39) T11A probably damaging Het
Fbxl18 A G 5: 142,871,840 (GRCm39) L465P probably damaging Het
Fbxw27 G A 9: 109,601,187 (GRCm39) T311I probably damaging Het
Fhip1b A T 7: 105,038,542 (GRCm39) D232E probably damaging Het
Fstl5 C T 3: 76,317,801 (GRCm39) Q156* probably null Het
Ggn G T 7: 28,871,621 (GRCm39) G334C probably damaging Het
Grik2 T C 10: 49,008,841 (GRCm39) N749D probably damaging Het
Helb A G 10: 119,946,786 (GRCm39) S176P probably benign Het
Hyal1 A G 9: 107,456,153 (GRCm39) D73G probably benign Het
Ifi205 C A 1: 173,842,574 (GRCm39) R374I probably benign Het
Ift172 A T 5: 31,429,460 (GRCm39) V567D possibly damaging Het
Ighv1-43 A T 12: 114,909,845 (GRCm39) S26T possibly damaging Het
Il21 C A 3: 37,286,653 (GRCm39) S21I probably damaging Het
Jam3 A G 9: 27,009,669 (GRCm39) V309A probably damaging Het
Kcnh4 A T 11: 100,637,659 (GRCm39) L666Q probably damaging Het
Kcnk10 A G 12: 98,406,946 (GRCm39) V250A probably benign Het
Lama1 A G 17: 68,044,677 (GRCm39) Y192C probably damaging Het
Lamb2 G A 9: 108,364,846 (GRCm39) R1200H probably damaging Het
Lilra6 T G 7: 3,917,382 (GRCm39) R204S probably benign Het
Lrrn1 A G 6: 107,545,668 (GRCm39) I489V probably benign Het
Mdh2 T A 5: 135,812,263 (GRCm39) D57E probably damaging Het
Mfsd2a A G 4: 122,844,302 (GRCm39) S282P probably benign Het
Midn T A 10: 79,986,018 (GRCm39) I36N probably damaging Het
Mpped1 A T 15: 83,680,907 (GRCm39) probably benign Het
Myh10 A G 11: 68,689,197 (GRCm39) D1258G possibly damaging Het
Nup62 T C 7: 44,478,449 (GRCm39) S155P possibly damaging Het
Or2g7 A T 17: 38,378,638 (GRCm39) H192L possibly damaging Het
Or2t46 A G 11: 58,472,455 (GRCm39) T262A possibly damaging Het
Or52ab7 A T 7: 102,978,040 (GRCm39) M116L probably benign Het
Pex7 T C 10: 19,745,078 (GRCm39) T258A probably benign Het
Plg A G 17: 12,621,976 (GRCm39) D432G probably damaging Het
Plxnd1 A T 6: 115,971,337 (GRCm39) S144T probably damaging Het
Prkch T C 12: 73,749,667 (GRCm39) F420S possibly damaging Het
Psg26 A G 7: 18,209,235 (GRCm39) V391A probably benign Het
Psg29 G A 7: 16,942,556 (GRCm39) G186R probably damaging Het
Rev3l T A 10: 39,699,574 (GRCm39) I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,229,123 (GRCm39) probably benign Het
Runx1 T A 16: 92,441,235 (GRCm39) probably null Het
Sapcd1 A T 17: 35,245,427 (GRCm39) S119T possibly damaging Het
Sema5a T A 15: 32,679,332 (GRCm39) N870K probably damaging Het
Serpina3f G A 12: 104,183,314 (GRCm39) E59K probably benign Het
Slc8b1 A G 5: 120,662,352 (GRCm39) K299E possibly damaging Het
Slco1b2 G A 6: 141,603,283 (GRCm39) M221I probably benign Het
Smg5 C T 3: 88,263,032 (GRCm39) Q812* probably null Het
Smr3a T G 5: 88,155,962 (GRCm39) probably null Het
Syt9 G A 7: 107,103,479 (GRCm39) D426N probably damaging Het
Tcf25 T C 8: 124,115,374 (GRCm39) Y204H probably benign Het
Tmeff2 T A 1: 51,018,715 (GRCm39) C232* probably null Het
Tmem184a C A 5: 139,793,757 (GRCm39) G219V probably null Het
Tnc G T 4: 63,924,485 (GRCm39) T1071K possibly damaging Het
Tnn C A 1: 159,948,188 (GRCm39) G842W probably damaging Het
Tshz3 T A 7: 36,470,615 (GRCm39) I868N probably benign Het
Ulbp1 C T 10: 7,397,391 (GRCm39) R238H probably benign Het
Ushbp1 C T 8: 71,847,693 (GRCm39) probably null Het
Usp34 G C 11: 23,438,982 (GRCm39) D3515H probably damaging Het
Wdr91 T C 6: 34,887,726 (GRCm39) E10G probably damaging Het
Xdh A T 17: 74,205,965 (GRCm39) F1016L probably benign Het
Zfp235 T G 7: 23,841,609 (GRCm39) I676S possibly damaging Het
Zfp619 G A 7: 39,186,811 (GRCm39) C947Y probably damaging Het
Zfp663 A G 2: 165,195,731 (GRCm39) S163P probably damaging Het
Zfp93 A G 7: 23,974,836 (GRCm39) I274V probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Clcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Clcn4 APN 7 7,290,672 (GRCm39) missense probably damaging 0.99
IGL01090:Clcn4 APN 7 7,297,035 (GRCm39) missense probably benign 0.01
IGL01650:Clcn4 APN 7 7,287,280 (GRCm39) splice site probably benign
IGL02404:Clcn4 APN 7 7,290,857 (GRCm39) missense probably benign 0.04
IGL02493:Clcn4 APN 7 7,287,243 (GRCm39) missense probably damaging 1.00
IGL02556:Clcn4 APN 7 7,299,065 (GRCm39) missense probably benign
IGL02661:Clcn4 APN 7 7,294,730 (GRCm39) splice site probably null
IGL02816:Clcn4 APN 7 7,298,087 (GRCm39) missense probably damaging 1.00
IGL02882:Clcn4 APN 7 7,293,464 (GRCm39) missense probably damaging 1.00
IGL03205:Clcn4 APN 7 7,293,419 (GRCm39) missense probably damaging 1.00
IGL03289:Clcn4 APN 7 7,287,257 (GRCm39) missense probably damaging 1.00
Delipidated UTSW 7 7,296,060 (GRCm39) missense probably damaging 1.00
R0183:Clcn4 UTSW 7 7,298,090 (GRCm39) nonsense probably null
R0379:Clcn4 UTSW 7 7,299,791 (GRCm39) missense probably damaging 0.99
R0555:Clcn4 UTSW 7 7,293,503 (GRCm39) missense possibly damaging 0.65
R0890:Clcn4 UTSW 7 7,291,964 (GRCm39) missense possibly damaging 0.89
R1463:Clcn4 UTSW 7 7,299,763 (GRCm39) nonsense probably null
R1549:Clcn4 UTSW 7 7,294,681 (GRCm39) missense probably damaging 1.00
R1563:Clcn4 UTSW 7 7,296,981 (GRCm39) missense probably damaging 1.00
R1966:Clcn4 UTSW 7 7,287,184 (GRCm39) makesense probably null
R2764:Clcn4 UTSW 7 7,299,798 (GRCm39) missense possibly damaging 0.81
R2874:Clcn4 UTSW 7 7,293,520 (GRCm39) missense probably benign 0.33
R4023:Clcn4 UTSW 7 7,293,427 (GRCm39) missense probably damaging 1.00
R4024:Clcn4 UTSW 7 7,293,427 (GRCm39) missense probably damaging 1.00
R4152:Clcn4 UTSW 7 7,297,833 (GRCm39) missense probably benign 0.02
R4154:Clcn4 UTSW 7 7,297,833 (GRCm39) missense probably benign 0.02
R4298:Clcn4 UTSW 7 7,299,737 (GRCm39) missense possibly damaging 0.93
R4535:Clcn4 UTSW 7 7,290,813 (GRCm39) missense probably benign 0.01
R4574:Clcn4 UTSW 7 7,290,804 (GRCm39) missense probably benign 0.23
R5158:Clcn4 UTSW 7 7,294,618 (GRCm39) missense possibly damaging 0.94
R5302:Clcn4 UTSW 7 7,297,050 (GRCm39) missense possibly damaging 0.95
R5369:Clcn4 UTSW 7 7,299,032 (GRCm39) missense probably benign 0.26
R5624:Clcn4 UTSW 7 7,291,943 (GRCm39) missense probably benign 0.35
R5626:Clcn4 UTSW 7 7,292,017 (GRCm39) missense probably damaging 1.00
R5723:Clcn4 UTSW 7 7,294,681 (GRCm39) missense probably damaging 1.00
R6154:Clcn4 UTSW 7 7,294,481 (GRCm39) missense probably benign 0.00
R6259:Clcn4 UTSW 7 7,294,529 (GRCm39) missense possibly damaging 0.92
R6396:Clcn4 UTSW 7 7,297,024 (GRCm39) missense probably damaging 1.00
R6783:Clcn4 UTSW 7 7,302,181 (GRCm39) unclassified probably benign
R7320:Clcn4 UTSW 7 7,294,827 (GRCm39) missense probably benign 0.19
R7562:Clcn4 UTSW 7 7,298,081 (GRCm39) missense possibly damaging 0.92
R7586:Clcn4 UTSW 7 7,296,958 (GRCm39) missense probably benign 0.00
R7752:Clcn4 UTSW 7 7,296,936 (GRCm39) missense probably benign
R7860:Clcn4 UTSW 7 7,296,060 (GRCm39) missense probably damaging 1.00
R7872:Clcn4 UTSW 7 7,290,780 (GRCm39) missense probably benign
R7895:Clcn4 UTSW 7 7,298,167 (GRCm39) missense probably benign 0.26
R8069:Clcn4 UTSW 7 7,299,758 (GRCm39) missense probably damaging 0.99
R8083:Clcn4 UTSW 7 7,294,427 (GRCm39) missense possibly damaging 0.69
R9185:Clcn4 UTSW 7 7,287,197 (GRCm39) missense possibly damaging 0.74
R9281:Clcn4 UTSW 7 7,294,813 (GRCm39) missense probably benign 0.16
R9333:Clcn4 UTSW 7 7,292,192 (GRCm39) missense probably damaging 1.00
R9682:Clcn4 UTSW 7 7,299,797 (GRCm39) missense probably benign 0.02
X0019:Clcn4 UTSW 7 7,294,609 (GRCm39) missense probably damaging 1.00
Z1177:Clcn4 UTSW 7 7,297,755 (GRCm39) missense probably damaging 0.96
Z1177:Clcn4 UTSW 7 7,296,039 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTTTCCAGCGATCTCAAGGGC -3'
(R):5'- CACCAGTGAGCTCATCTCTG -3'

Sequencing Primer
(F):5'- AGCAGACTGTGTGGTCTAATAG -3'
(R):5'- CTGAGCTCTTCAACGATTGTG -3'
Posted On 2016-04-27