Incidental Mutation 'R4977:Clcn4'
ID382754
Institutional Source Beutler Lab
Gene Symbol Clcn4
Ensembl Gene ENSMUSG00000000605
Gene Namechloride channel, voltage-sensitive 4
SynonymsClc4-2, Clcn4-2
MMRRC Submission 042572-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4977 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location7282309-7300851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7291437 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 411 (I411F)
Ref Sequence ENSEMBL: ENSMUSP00000148174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000619] [ENSMUST00000209916] [ENSMUST00000210061] [ENSMUST00000210362] [ENSMUST00000210594] [ENSMUST00000211574]
Predicted Effect probably benign
Transcript: ENSMUST00000000619
AA Change: I442F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000619
Gene: ENSMUSG00000000605
AA Change: I442F

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Voltage_CLC 149 552 2.7e-111 PFAM
CBS 596 646 1.07e-1 SMART
CBS 687 734 4.92e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209916
Predicted Effect probably benign
Transcript: ENSMUST00000210061
AA Change: I411F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210318
Predicted Effect probably benign
Transcript: ENSMUST00000210362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210444
Predicted Effect probably benign
Transcript: ENSMUST00000210594
AA Change: I382F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211551
Predicted Effect probably benign
Transcript: ENSMUST00000211574
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. Chloride channel 4 has an evolutionary conserved CpG island and is conserved in both mouse and hamster. This gene is mapped in close proximity to APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), which are both located on the human X chromosome at band p22.3. The physiological role of chloride channel 4 remains unknown but may contribute to the pathogenesis of neuronal disorders. Alternate splicing results in two transcript variants that encode different proteins. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,136,073 D910G probably benign Het
Amy1 C T 3: 113,569,377 probably null Het
C1s2 A G 6: 124,635,639 M19T probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Cdyl2 A G 8: 116,575,269 C458R probably damaging Het
Cep112 T C 11: 108,434,236 S35P probably damaging Het
Chd9 T C 8: 91,033,708 L2027P possibly damaging Het
Cyp3a57 T C 5: 145,349,426 probably null Het
Dis3l A C 9: 64,307,201 S919A probably benign Het
Dnah8 A G 17: 30,663,301 T616A probably benign Het
Emx2 A G 19: 59,459,246 T11A probably damaging Het
Fam160a2 A T 7: 105,389,335 D232E probably damaging Het
Fbxl18 A G 5: 142,886,085 L465P probably damaging Het
Fbxw27 G A 9: 109,772,119 T311I probably damaging Het
Fstl5 C T 3: 76,410,494 Q156* probably null Het
Ggn G T 7: 29,172,196 G334C probably damaging Het
Grik2 T C 10: 49,132,745 N749D probably damaging Het
Helb A G 10: 120,110,881 S176P probably benign Het
Hyal1 A G 9: 107,578,954 D73G probably benign Het
Ifi205 C A 1: 174,015,008 R374I probably benign Het
Ift172 A T 5: 31,272,116 V567D possibly damaging Het
Ighv1-43 A T 12: 114,946,225 S26T possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Jam3 A G 9: 27,098,373 V309A probably damaging Het
Kcnh4 A T 11: 100,746,833 L666Q probably damaging Het
Kcnk10 A G 12: 98,440,687 V250A probably benign Het
Lama1 A G 17: 67,737,682 Y192C probably damaging Het
Lamb2 G A 9: 108,487,647 R1200H probably damaging Het
Lilra6 T G 7: 3,914,383 R204S probably benign Het
Lrrn1 A G 6: 107,568,707 I489V probably benign Het
Mdh2 T A 5: 135,783,409 D57E probably damaging Het
Mfsd2a A G 4: 122,950,509 S282P probably benign Het
Midn T A 10: 80,150,184 I36N probably damaging Het
Mpped1 A T 15: 83,796,706 probably benign Het
Myh10 A G 11: 68,798,371 D1258G possibly damaging Het
Nup62 T C 7: 44,829,025 S155P possibly damaging Het
Olfr130 A T 17: 38,067,747 H192L possibly damaging Het
Olfr325 A G 11: 58,581,629 T262A possibly damaging Het
Olfr598 A T 7: 103,328,833 M116L probably benign Het
Pex7 T C 10: 19,869,332 T258A probably benign Het
Plg A G 17: 12,403,089 D432G probably damaging Het
Plxnd1 A T 6: 115,994,376 S144T probably damaging Het
Prkch T C 12: 73,702,893 F420S possibly damaging Het
Psg26 A G 7: 18,475,310 V391A probably benign Het
Psg29 G A 7: 17,208,631 G186R probably damaging Het
Rev3l T A 10: 39,823,578 I1357K possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,916 probably benign Het
Runx1 T A 16: 92,644,347 probably null Het
Sapcd1 A T 17: 35,026,451 S119T possibly damaging Het
Sema5a T A 15: 32,679,186 N870K probably damaging Het
Serpina3f G A 12: 104,217,055 E59K probably benign Het
Slc8b1 A G 5: 120,524,287 K299E possibly damaging Het
Slco1b2 G A 6: 141,657,557 M221I probably benign Het
Smg5 C T 3: 88,355,725 Q812* probably null Het
Smr3a T G 5: 88,008,103 probably null Het
Syt9 G A 7: 107,504,272 D426N probably damaging Het
Tcf25 T C 8: 123,388,635 Y204H probably benign Het
Tmeff2 T A 1: 50,979,556 C232* probably null Het
Tmem184a C A 5: 139,808,002 G219V probably null Het
Tnc G T 4: 64,006,248 T1071K possibly damaging Het
Tnn C A 1: 160,120,618 G842W probably damaging Het
Tshz3 T A 7: 36,771,190 I868N probably benign Het
Ulbp1 C T 10: 7,447,391 R238H probably benign Het
Ushbp1 C T 8: 71,395,049 probably null Het
Usp34 G C 11: 23,488,982 D3515H probably damaging Het
Wdr91 T C 6: 34,910,791 E10G probably damaging Het
Xdh A T 17: 73,898,970 F1016L probably benign Het
Zfp235 T G 7: 24,142,184 I676S possibly damaging Het
Zfp619 G A 7: 39,537,387 C947Y probably damaging Het
Zfp663 A G 2: 165,353,811 S163P probably damaging Het
Zfp93 A G 7: 24,275,411 I274V probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Clcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Clcn4 APN 7 7287673 missense probably damaging 0.99
IGL01090:Clcn4 APN 7 7294036 missense probably benign 0.01
IGL01650:Clcn4 APN 7 7284281 splice site probably benign
IGL02404:Clcn4 APN 7 7287858 missense probably benign 0.04
IGL02493:Clcn4 APN 7 7284244 missense probably damaging 1.00
IGL02556:Clcn4 APN 7 7296066 missense probably benign
IGL02661:Clcn4 APN 7 7291731 splice site probably null
IGL02816:Clcn4 APN 7 7295088 missense probably damaging 1.00
IGL02882:Clcn4 APN 7 7290465 missense probably damaging 1.00
IGL03205:Clcn4 APN 7 7290420 missense probably damaging 1.00
IGL03289:Clcn4 APN 7 7284258 missense probably damaging 1.00
Delipidated UTSW 7 7293061 missense probably damaging 1.00
R0183:Clcn4 UTSW 7 7295091 nonsense probably null
R0379:Clcn4 UTSW 7 7296792 missense probably damaging 0.99
R0555:Clcn4 UTSW 7 7290504 missense possibly damaging 0.65
R0890:Clcn4 UTSW 7 7288965 missense possibly damaging 0.89
R1463:Clcn4 UTSW 7 7296764 nonsense probably null
R1549:Clcn4 UTSW 7 7291682 missense probably damaging 1.00
R1563:Clcn4 UTSW 7 7293982 missense probably damaging 1.00
R1966:Clcn4 UTSW 7 7284185 makesense probably null
R2764:Clcn4 UTSW 7 7296799 missense possibly damaging 0.81
R2874:Clcn4 UTSW 7 7290521 missense probably benign 0.33
R4023:Clcn4 UTSW 7 7290428 missense probably damaging 1.00
R4024:Clcn4 UTSW 7 7290428 missense probably damaging 1.00
R4152:Clcn4 UTSW 7 7294834 missense probably benign 0.02
R4154:Clcn4 UTSW 7 7294834 missense probably benign 0.02
R4298:Clcn4 UTSW 7 7296738 missense possibly damaging 0.93
R4535:Clcn4 UTSW 7 7287814 missense probably benign 0.01
R4574:Clcn4 UTSW 7 7287805 missense probably benign 0.23
R5158:Clcn4 UTSW 7 7291619 missense possibly damaging 0.94
R5302:Clcn4 UTSW 7 7294051 missense possibly damaging 0.95
R5369:Clcn4 UTSW 7 7296033 missense probably benign 0.26
R5624:Clcn4 UTSW 7 7288944 missense probably benign 0.35
R5626:Clcn4 UTSW 7 7289018 missense probably damaging 1.00
R5723:Clcn4 UTSW 7 7291682 missense probably damaging 1.00
R6154:Clcn4 UTSW 7 7291482 missense probably benign 0.00
R6259:Clcn4 UTSW 7 7291530 missense possibly damaging 0.92
R6396:Clcn4 UTSW 7 7294025 missense probably damaging 1.00
R6783:Clcn4 UTSW 7 7299182 unclassified probably benign
R7320:Clcn4 UTSW 7 7291828 missense probably benign 0.19
R7562:Clcn4 UTSW 7 7295082 missense possibly damaging 0.92
R7586:Clcn4 UTSW 7 7293959 missense probably benign 0.00
R7752:Clcn4 UTSW 7 7293937 missense probably benign
R7860:Clcn4 UTSW 7 7293061 missense probably damaging 1.00
R7872:Clcn4 UTSW 7 7287781 missense probably benign
R7895:Clcn4 UTSW 7 7295168 missense probably benign 0.26
R8069:Clcn4 UTSW 7 7296759 missense probably damaging 0.99
R8083:Clcn4 UTSW 7 7291428 missense possibly damaging 0.69
X0019:Clcn4 UTSW 7 7291610 missense probably damaging 1.00
Z1177:Clcn4 UTSW 7 7293040 nonsense probably null
Z1177:Clcn4 UTSW 7 7294756 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTTTCCAGCGATCTCAAGGGC -3'
(R):5'- CACCAGTGAGCTCATCTCTG -3'

Sequencing Primer
(F):5'- AGCAGACTGTGTGGTCTAATAG -3'
(R):5'- CTGAGCTCTTCAACGATTGTG -3'
Posted On2016-04-27