Incidental Mutation 'R5091:Synpo'
ID387784
Institutional Source Beutler Lab
Gene Symbol Synpo
Ensembl Gene ENSMUSG00000043079
Gene Namesynaptopodin
Synonyms9030217H17Rik, 9330140I15Rik
MMRRC Submission 042680-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R5091 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location60593973-60660142 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 60602759 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 466 (S466*)
Ref Sequence ENSEMBL: ENSMUSP00000117897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097566] [ENSMUST00000115318] [ENSMUST00000123288] [ENSMUST00000130044] [ENSMUST00000130360] [ENSMUST00000143275] [ENSMUST00000155195]
Predicted Effect probably null
Transcript: ENSMUST00000097566
AA Change: S466*
SMART Domains Protein: ENSMUSP00000095174
Gene: ENSMUSG00000043079
AA Change: S466*

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115318
AA Change: S466*
SMART Domains Protein: ENSMUSP00000110973
Gene: ENSMUSG00000043079
AA Change: S466*

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128528
Predicted Effect probably null
Transcript: ENSMUST00000130044
AA Change: S466*
SMART Domains Protein: ENSMUSP00000121756
Gene: ENSMUSG00000043079
AA Change: S466*

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000130360
AA Change: S705*
SMART Domains Protein: ENSMUSP00000115355
Gene: ENSMUSG00000043079
AA Change: S705*

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
low complexity region 913 940 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1029 1045 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137894
Predicted Effect probably null
Transcript: ENSMUST00000143275
AA Change: S705*
SMART Domains Protein: ENSMUSP00000125272
Gene: ENSMUSG00000043079
AA Change: S705*

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155195
AA Change: S466*
SMART Domains Protein: ENSMUSP00000117897
Gene: ENSMUSG00000043079
AA Change: S466*

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160395
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptopodin is an actin-associated protein that may play a role in actin-based cell shape and motility. The name synaptopodin derives from the protein's associations with postsynaptic densities and dendritic spines and with renal podocytes (Mundel et al., 1997 [PubMed 9314539]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in telencephalic neurons, reduced long term potentiation, and behavioral abnormalities including hypoactivity, reduced anxiety, and learning deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Synpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Synpo APN 18 60604077 missense probably damaging 1.00
IGL00976:Synpo APN 18 60603419 missense possibly damaging 0.74
IGL01808:Synpo APN 18 60602208 missense probably benign 0.01
IGL02116:Synpo APN 18 60603456 missense probably damaging 1.00
IGL02444:Synpo APN 18 60602430 missense probably damaging 1.00
IGL02838:Synpo APN 18 60603800 missense probably damaging 1.00
R0420:Synpo UTSW 18 60602418 missense probably damaging 0.97
R0650:Synpo UTSW 18 60602340 missense possibly damaging 0.83
R0790:Synpo UTSW 18 60603503 missense probably damaging 0.98
R1213:Synpo UTSW 18 60602453 missense possibly damaging 0.83
R1695:Synpo UTSW 18 60603387 missense probably benign 0.00
R1763:Synpo UTSW 18 60602784 missense probably damaging 1.00
R1920:Synpo UTSW 18 60603589 missense probably benign 0.00
R1921:Synpo UTSW 18 60603589 missense probably benign 0.00
R2133:Synpo UTSW 18 60602895 missense probably damaging 1.00
R3757:Synpo UTSW 18 60602990 missense probably damaging 1.00
R4796:Synpo UTSW 18 60604314 missense probably damaging 0.97
R4841:Synpo UTSW 18 60603612 missense probably damaging 0.99
R4842:Synpo UTSW 18 60603612 missense probably damaging 0.99
R4911:Synpo UTSW 18 60629864 utr 5 prime probably benign
R5327:Synpo UTSW 18 60603846 missense possibly damaging 0.93
R5354:Synpo UTSW 18 60602231 critical splice donor site probably null
R5671:Synpo UTSW 18 60595950 missense probably damaging 0.99
R5868:Synpo UTSW 18 60604046 missense probably damaging 1.00
R6007:Synpo UTSW 18 60603615 missense probably benign 0.35
R7266:Synpo UTSW 18 60629559 missense probably benign 0.00
R7472:Synpo UTSW 18 60629823 missense probably benign 0.00
R7509:Synpo UTSW 18 60603494 missense probably damaging 1.00
R7554:Synpo UTSW 18 60603333 missense probably benign 0.21
R7584:Synpo UTSW 18 60596277 missense probably damaging 0.96
R7615:Synpo UTSW 18 60604475 missense probably damaging 1.00
R7633:Synpo UTSW 18 60603428 missense probably damaging 1.00
R8499:Synpo UTSW 18 60602972 missense probably damaging 1.00
R8512:Synpo UTSW 18 60602411 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTAAGGATGCCACTCGGAAG -3'
(R):5'- CTAGTGCAGACAGCTGATGAG -3'

Sequencing Primer
(F):5'- CACTCGGAAGCCCCCAG -3'
(R):5'- CAGACAGCTGATGAGAAGCG -3'
Posted On2016-06-06