Incidental Mutation 'R5092:Dcaf8'
ID387796
Institutional Source Beutler Lab
Gene Symbol Dcaf8
Ensembl Gene ENSMUSG00000026554
Gene NameDDB1 and CUL4 associated factor 8
SynonymsD1Dau35e, Wdr42a, D1Ucla4, H326
MMRRC Submission 042681-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R5092 (G1)
Quality Score198
Status Not validated
Chromosome1
Chromosomal Location172148084-172197005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172186909 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 394 (T394A)
Ref Sequence ENSEMBL: ENSMUSP00000141732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074144] [ENSMUST00000191689] [ENSMUST00000192704] [ENSMUST00000193638]
Predicted Effect probably benign
Transcript: ENSMUST00000074144
AA Change: T394A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000073778
Gene: ENSMUSG00000026554
AA Change: T394A

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191689
AA Change: T394A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000141731
Gene: ENSMUSG00000026554
AA Change: T394A

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192428
Predicted Effect probably benign
Transcript: ENSMUST00000192704
AA Change: T394A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000141732
Gene: ENSMUSG00000026554
AA Change: T394A

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193638
SMART Domains Protein: ENSMUSP00000141836
Gene: ENSMUSG00000026554

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195011
Predicted Effect probably benign
Transcript: ENSMUST00000195345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195394
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,987,667 probably benign Het
4932438A13Rik A T 3: 37,000,085 M3118L probably benign Het
Abca13 T A 11: 9,258,535 L236Q probably damaging Het
Acp2 A T 2: 91,208,046 T255S probably benign Het
Acsf3 A C 8: 122,817,392 R536S probably benign Het
Adgrb1 T G 15: 74,529,815 V220G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atp5b A G 10: 128,083,985 Q74R probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
Capn9 A G 8: 124,597,525 K188R probably damaging Het
Casp8 A T 1: 58,844,676 N381Y possibly damaging Het
Cbwd1 A T 19: 24,921,019 probably null Het
Ccdc88b A G 19: 6,848,232 S1218P probably damaging Het
Cdc42bpg C T 19: 6,313,220 P403S probably benign Het
Cdkal1 T A 13: 29,846,239 Y91F probably damaging Het
Cdyl2 T C 8: 116,623,940 N151D possibly damaging Het
Cnot1 T A 8: 95,752,768 R875S possibly damaging Het
Cpd A G 11: 76,811,704 S613P possibly damaging Het
Cyhr1 A T 15: 76,646,312 F269L probably benign Het
Cyp2e1 G T 7: 140,774,735 R492L probably damaging Het
D5Ertd579e G A 5: 36,602,703 T1371M probably benign Het
Dgka T C 10: 128,735,833 E117G probably damaging Het
Dock4 G A 12: 40,844,441 V1867I probably benign Het
E2f2 G T 4: 136,186,937 A333S probably benign Het
Eif3l T C 15: 79,084,154 S208P probably benign Het
Elovl3 A T 19: 46,134,522 H179L probably damaging Het
Eml5 T C 12: 98,792,616 D1766G probably damaging Het
Eno4 A G 19: 58,945,591 T75A probably benign Het
Fam135a C T 1: 24,028,807 D94N probably benign Het
Fasn G T 11: 120,815,036 Q1136K probably benign Het
Fcer1a T G 1: 173,225,455 N58T probably damaging Het
Frmd4b T A 6: 97,295,980 D763V probably damaging Het
Gm43518 A G 5: 123,938,234 T115A probably damaging Het
Gria4 C T 9: 4,472,176 E438K probably benign Het
Grin2d T C 7: 45,854,268 E681G probably damaging Het
Gtf3c5 G T 2: 28,582,873 N35K possibly damaging Het
Hydin A G 8: 110,582,668 T4031A probably benign Het
Igfn1 G T 1: 135,964,826 N2185K probably benign Het
Il17rb T C 14: 30,002,376 T174A probably benign Het
Kdm3b T A 18: 34,813,462 C835S probably benign Het
Lgi2 A T 5: 52,538,087 I510N probably damaging Het
Map3k6 A G 4: 133,251,743 E1164G probably benign Het
Mpv17l T A 16: 13,940,673 M1K probably null Het
Myoc T A 1: 162,639,634 L124Q probably damaging Het
Nbeal2 C A 9: 110,626,728 probably null Het
Nek10 A G 14: 14,820,851 K13E possibly damaging Het
Nt5dc2 A G 14: 31,139,032 H491R possibly damaging Het
Olfr1053 T C 2: 86,314,362 Q308R probably benign Het
Olfr1314 A C 2: 112,092,107 M198R possibly damaging Het
Olfr65 T A 7: 103,907,199 Y250* probably null Het
Pclo T A 5: 14,677,308 probably benign Het
Pgm1 A T 5: 64,107,749 N371I possibly damaging Het
Phf20l1 T A 15: 66,636,913 S873T possibly damaging Het
Plch1 T C 3: 63,698,710 T1249A probably benign Het
Plekhn1 A T 4: 156,224,765 I228N possibly damaging Het
Ppp1r12a A T 10: 108,267,402 probably null Het
Ptchd3 T C 11: 121,831,146 Y282H probably damaging Het
Ptprk T A 10: 28,592,773 N1396K probably damaging Het
Rap1gap2 T C 11: 74,438,295 E81G probably damaging Het
Rpf2 T C 10: 40,246,975 M1V probably null Het
Rpgrip1l G A 8: 91,221,384 Q1224* probably null Het
Rreb1 A G 13: 37,928,278 D286G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Senp5 A T 16: 31,989,142 N431K probably benign Het
Serpina1f A C 12: 103,693,550 S158A probably damaging Het
Sertad3 T A 7: 27,476,720 I193N probably damaging Het
Slc22a8 T A 19: 8,594,164 N86K probably damaging Het
Slc6a2 T C 8: 92,994,719 V492A possibly damaging Het
Slf2 T A 19: 44,952,084 D773E probably benign Het
Slmap A C 14: 26,463,589 L272R probably damaging Het
Smyd5 T C 6: 85,445,203 probably benign Het
Snx21 G T 2: 164,786,746 R103L probably damaging Het
Sphk2 T A 7: 45,712,353 probably null Het
Stab1 T C 14: 31,145,855 K1653E probably benign Het
Syde1 A G 10: 78,589,418 V253A probably benign Het
Sympk G T 7: 19,042,659 R492L probably benign Het
Taar7f T C 10: 24,049,553 I15T probably benign Het
Tas2r137 A G 6: 40,491,266 D10G probably benign Het
Tbcc A G 17: 46,891,674 S329G probably benign Het
Teddm3 G A 16: 21,153,150 T223M probably benign Het
Tex14 G T 11: 87,514,842 C860F probably benign Het
Thada A T 17: 84,444,468 L360Q probably damaging Het
Thop1 C A 10: 81,080,578 H473Q probably damaging Het
Tln2 T C 9: 67,256,028 D1075G probably benign Het
Tmem130 G A 5: 144,743,718 T292I probably benign Het
Tmem198b T C 10: 128,801,436 N278S probably benign Het
Ttc21a A T 9: 119,942,665 T177S probably benign Het
Ubr2 A T 17: 46,969,247 C659S probably damaging Het
Vmn2r4 T C 3: 64,390,952 K585R probably benign Het
Vmn2r86 A G 10: 130,446,587 I720T probably damaging Het
Wdr35 G T 12: 8,987,327 W311L probably damaging Het
Zfp39 A T 11: 58,891,202 F245I possibly damaging Het
Zmym5 G A 14: 56,796,779 T325I probably benign Het
Other mutations in Dcaf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03163:Dcaf8 APN 1 172172908 missense probably damaging 1.00
FR4976:Dcaf8 UTSW 1 172172856 missense probably damaging 1.00
PIT4362001:Dcaf8 UTSW 1 172172797 missense probably damaging 0.96
R0329:Dcaf8 UTSW 1 172187411 missense probably benign 0.42
R0458:Dcaf8 UTSW 1 172174043 missense probably benign 0.00
R0729:Dcaf8 UTSW 1 172172654 missense probably benign
R0731:Dcaf8 UTSW 1 172172509 missense possibly damaging 0.66
R1389:Dcaf8 UTSW 1 172174052 missense probably benign 0.00
R1496:Dcaf8 UTSW 1 172193855 missense probably benign 0.39
R1719:Dcaf8 UTSW 1 172175495 missense probably damaging 0.96
R1856:Dcaf8 UTSW 1 172175553 missense probably damaging 1.00
R2342:Dcaf8 UTSW 1 172186361 missense possibly damaging 0.48
R2512:Dcaf8 UTSW 1 172189035 missense possibly damaging 0.95
R4163:Dcaf8 UTSW 1 172192570 missense probably damaging 1.00
R4546:Dcaf8 UTSW 1 172179893 splice site probably benign
R4880:Dcaf8 UTSW 1 172187489 intron probably benign
R5622:Dcaf8 UTSW 1 172186398 intron probably benign
R5734:Dcaf8 UTSW 1 172172911 missense possibly damaging 0.65
R6245:Dcaf8 UTSW 1 172165867 start codon destroyed probably benign 0.01
R7090:Dcaf8 UTSW 1 172188968 missense probably damaging 0.96
R8178:Dcaf8 UTSW 1 172186319 missense probably benign 0.22
Z1176:Dcaf8 UTSW 1 172172929 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ACAGGGCCTCAGTAAGACTC -3'
(R):5'- CCAAGGGTCGTCTGCTATAGTC -3'

Sequencing Primer
(F):5'- GCCTCAGTAAGACTCTGCTATTAAGG -3'
(R):5'- ATAGTCTGCTATAGTCCCACTACATG -3'
Posted On2016-06-06