Incidental Mutation 'R1856:Dcaf8'
ID 206077
Institutional Source Beutler Lab
Gene Symbol Dcaf8
Ensembl Gene ENSMUSG00000026554
Gene Name DDB1 and CUL4 associated factor 8
Synonyms D1Ucla4, D1Dau35e, Wdr42a, H326
MMRRC Submission 039880-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.840) question?
Stock # R1856 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 171975574-172023960 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 172003120 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 306 (D306G)
Ref Sequence ENSEMBL: ENSMUSP00000141836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074144] [ENSMUST00000191689] [ENSMUST00000192704] [ENSMUST00000193638]
AlphaFold Q8N7N5
Predicted Effect probably damaging
Transcript: ENSMUST00000074144
AA Change: D306G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073778
Gene: ENSMUSG00000026554
AA Change: D306G

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191689
AA Change: D306G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141731
Gene: ENSMUSG00000026554
AA Change: D306G

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192428
Predicted Effect probably damaging
Transcript: ENSMUST00000192704
AA Change: D306G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141732
Gene: ENSMUSG00000026554
AA Change: D306G

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193638
AA Change: D306G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141836
Gene: ENSMUSG00000026554
AA Change: D306G

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000195345
AA Change: D32G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194972
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T A 4: 144,504,453 (GRCm39) M233L probably benign Het
Abca14 T G 7: 119,877,404 (GRCm39) F1017L probably damaging Het
Abcb11 A C 2: 69,076,267 (GRCm39) V1147G probably damaging Het
Abcc10 T A 17: 46,617,529 (GRCm39) S1128C probably damaging Het
Adam6a G A 12: 113,508,923 (GRCm39) C432Y probably damaging Het
Adamdec1 C T 14: 68,808,397 (GRCm39) V318M probably damaging Het
Ahnak C A 19: 8,979,412 (GRCm39) S232Y possibly damaging Het
Amt A C 9: 108,174,361 (GRCm39) H42P probably damaging Het
Anapc1 A T 2: 128,501,708 (GRCm39) L778Q probably damaging Het
Ankhd1 G A 18: 36,777,580 (GRCm39) A1588T probably benign Het
Anln A T 9: 22,264,627 (GRCm39) L881Q probably damaging Het
Appl1 A G 14: 26,649,706 (GRCm39) S607P probably damaging Het
Arg2 G T 12: 79,194,436 (GRCm39) V87L probably benign Het
Atp13a2 C T 4: 140,731,323 (GRCm39) P869L probably benign Het
Atxn7l1 T A 12: 33,408,769 (GRCm39) D310E probably damaging Het
Cd6 A T 19: 10,775,966 (GRCm39) D164E probably damaging Het
Cdan1 C A 2: 120,555,417 (GRCm39) V775L probably benign Het
Cep164 A T 9: 45,687,056 (GRCm39) probably null Het
Cep41 A G 6: 30,661,005 (GRCm39) S61P probably damaging Het
Clcn7 C A 17: 25,379,445 (GRCm39) D764E probably damaging Het
Cog2 G A 8: 125,278,142 (GRCm39) G703S possibly damaging Het
Cramp1 T C 17: 25,187,952 (GRCm39) D1214G probably damaging Het
Cst7 G T 2: 150,419,628 (GRCm39) C98F probably damaging Het
Ctc1 T A 11: 68,925,484 (GRCm39) L1007Q probably damaging Het
Cyb5r4 G A 9: 86,904,262 (GRCm39) A11T possibly damaging Het
Defb38 T A 8: 19,073,592 (GRCm39) K27I probably benign Het
Disp3 T C 4: 148,356,089 (GRCm39) E257G probably damaging Het
Dnajc6 T C 4: 101,456,185 (GRCm39) S58P probably damaging Het
Dock10 A T 1: 80,584,285 (GRCm39) D140E possibly damaging Het
Dop1a T C 9: 86,374,057 (GRCm39) V172A probably damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Eci3 C T 13: 35,137,011 (GRCm39) A171T possibly damaging Het
Eml2 A G 7: 18,927,986 (GRCm39) D284G probably damaging Het
Eml5 T C 12: 98,776,843 (GRCm39) D1377G probably damaging Het
Fam186a T C 15: 99,838,183 (GRCm39) E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 (GRCm39) L154R probably damaging Het
Gabrb2 A G 11: 42,517,540 (GRCm39) N454S probably benign Het
Gpr183 T A 14: 122,192,153 (GRCm39) I123L probably benign Het
Gucy1b1 A T 3: 81,965,659 (GRCm39) N62K probably benign Het
Hcrtr2 T C 9: 76,167,067 (GRCm39) N90S probably damaging Het
Hectd1 A T 12: 51,791,577 (GRCm39) L2556Q probably damaging Het
Hfm1 T A 5: 106,995,542 (GRCm39) M1290L probably benign Het
Hgsnat A G 8: 26,447,284 (GRCm39) W337R probably benign Het
Hmbox1 T C 14: 65,066,097 (GRCm39) Y291C probably damaging Het
Hmcn1 T C 1: 150,597,415 (GRCm39) N1749S probably benign Het
Igsf10 T C 3: 59,238,693 (GRCm39) D496G possibly damaging Het
Iqch C T 9: 63,441,619 (GRCm39) probably null Het
Irf6 A G 1: 192,849,843 (GRCm39) D255G probably benign Het
Kif9 G A 9: 110,346,787 (GRCm39) G642R probably null Het
Klhl20 A G 1: 160,934,312 (GRCm39) Y236H probably benign Het
Krt39 T A 11: 99,409,914 (GRCm39) K208* probably null Het
Lama3 T A 18: 12,670,838 (GRCm39) L808* probably null Het
Lrp5 C T 19: 3,647,346 (GRCm39) A1299T probably benign Het
Lysmd4 A G 7: 66,875,979 (GRCm39) Q214R probably benign Het
Macf1 T A 4: 123,263,641 (GRCm39) E6960V probably damaging Het
Mcpt2 A G 14: 56,281,156 (GRCm39) E120G probably benign Het
Mpeg1 A G 19: 12,439,720 (GRCm39) T393A probably benign Het
Myh4 G A 11: 67,146,508 (GRCm39) E1494K probably damaging Het
Nbas T G 12: 13,524,230 (GRCm39) S1695R possibly damaging Het
Nlgn1 G T 3: 25,494,201 (GRCm39) Y249* probably null Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Nup107 A G 10: 117,586,811 (GRCm39) L910P probably damaging Het
Obscn T A 11: 58,931,122 (GRCm39) D5838V probably damaging Het
Or10g7 T C 9: 39,905,655 (GRCm39) I183T probably benign Het
Or1j18 T C 2: 36,624,357 (GRCm39) I8T probably benign Het
Or4c113 G A 2: 88,885,203 (GRCm39) T189M possibly damaging Het
Or8d2b T C 9: 38,788,892 (GRCm39) I140T possibly damaging Het
Otogl G T 10: 107,690,125 (GRCm39) S915Y possibly damaging Het
P2rx7 T A 5: 122,819,095 (GRCm39) C506S probably damaging Het
P4hb T C 11: 120,454,044 (GRCm39) E350G probably benign Het
Papolg A T 11: 23,817,379 (GRCm39) V606E probably benign Het
Pappa A T 4: 65,258,980 (GRCm39) D1576V probably damaging Het
Pclo G T 5: 14,828,566 (GRCm39) V1402F probably damaging Het
Pdcd11 A G 19: 47,086,626 (GRCm39) T211A probably benign Het
Pdzd2 T C 15: 12,373,941 (GRCm39) R2065G possibly damaging Het
Plcl2 T C 17: 50,914,878 (GRCm39) V629A probably benign Het
Prkcsh G A 9: 21,915,871 (GRCm39) V92I possibly damaging Het
Prpf19 G T 19: 10,879,780 (GRCm39) V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 (GRCm39) I283F probably damaging Het
Rcc2 T A 4: 140,447,915 (GRCm39) D480E probably benign Het
Rnf182 G A 13: 43,821,518 (GRCm39) C23Y probably damaging Het
Rnf186 C T 4: 138,694,673 (GRCm39) T71I probably benign Het
Scyl3 A G 1: 163,761,265 (GRCm39) probably null Het
Slc12a6 G T 2: 112,166,272 (GRCm39) probably null Het
Slc1a2 C A 2: 102,607,912 (GRCm39) S520Y probably damaging Het
Slc35e2 T A 4: 155,696,186 (GRCm39) L191Q probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Snx33 T C 9: 56,833,295 (GRCm39) H258R possibly damaging Het
Tecpr2 A T 12: 110,899,498 (GRCm39) H622L probably benign Het
Thbs3 A T 3: 89,133,713 (GRCm39) E888D probably damaging Het
Tlk2 T C 11: 105,112,124 (GRCm39) L159P probably benign Het
Tmem70 A T 1: 16,747,497 (GRCm39) T205S probably damaging Het
Trappc10 T A 10: 78,032,285 (GRCm39) H1001L probably benign Het
Trim12a T C 7: 103,950,064 (GRCm39) T292A probably benign Het
Trip11 G A 12: 101,849,592 (GRCm39) R92* probably null Het
Trpa1 G A 1: 14,969,612 (GRCm39) Q386* probably null Het
Trpc4 T A 3: 54,187,410 (GRCm39) V454D probably damaging Het
Ttc36 A T 9: 44,714,051 (GRCm39) D22E probably benign Het
Ttk A T 9: 83,751,316 (GRCm39) I798F probably damaging Het
Ttn T C 2: 76,573,977 (GRCm39) I17312V probably damaging Het
Txndc15 A T 13: 55,865,875 (GRCm39) E113V possibly damaging Het
Ube2d4 T A 15: 58,718,448 (GRCm39) noncoding transcript Het
Urb1 T A 16: 90,558,583 (GRCm39) T1723S probably benign Het
Vmn1r65 A T 7: 6,011,265 (GRCm39) V323D possibly damaging Het
Vmn2r54 A G 7: 12,366,238 (GRCm39) M232T probably benign Het
Wdr59 A G 8: 112,202,813 (GRCm39) S577P probably damaging Het
Wfikkn2 C T 11: 94,128,949 (GRCm39) W397* probably null Het
Ypel1 T A 16: 16,899,511 (GRCm39) probably null Het
Ythdf1 T A 2: 180,552,763 (GRCm39) D484V probably damaging Het
Zdhhc17 A G 10: 110,783,154 (GRCm39) probably null Het
Zfp472 A T 17: 33,184,887 (GRCm39) H2L possibly damaging Het
Zfp953 A T 13: 67,493,422 (GRCm39) M74K probably benign Het
Zmat4 C T 8: 24,419,151 (GRCm39) T61M probably benign Het
Other mutations in Dcaf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03163:Dcaf8 APN 1 172,000,475 (GRCm39) missense probably damaging 1.00
FR4976:Dcaf8 UTSW 1 172,000,423 (GRCm39) missense probably damaging 1.00
PIT4362001:Dcaf8 UTSW 1 172,000,364 (GRCm39) missense probably damaging 0.96
R0329:Dcaf8 UTSW 1 172,014,978 (GRCm39) missense probably benign 0.42
R0458:Dcaf8 UTSW 1 172,001,610 (GRCm39) missense probably benign 0.00
R0729:Dcaf8 UTSW 1 172,000,221 (GRCm39) missense probably benign
R0731:Dcaf8 UTSW 1 172,000,076 (GRCm39) missense possibly damaging 0.66
R1389:Dcaf8 UTSW 1 172,001,619 (GRCm39) missense probably benign 0.00
R1496:Dcaf8 UTSW 1 172,021,422 (GRCm39) missense probably benign 0.39
R1719:Dcaf8 UTSW 1 172,003,062 (GRCm39) missense probably damaging 0.96
R2342:Dcaf8 UTSW 1 172,013,928 (GRCm39) missense possibly damaging 0.48
R2512:Dcaf8 UTSW 1 172,016,602 (GRCm39) missense possibly damaging 0.95
R4163:Dcaf8 UTSW 1 172,020,137 (GRCm39) missense probably damaging 1.00
R4546:Dcaf8 UTSW 1 172,007,460 (GRCm39) splice site probably benign
R4880:Dcaf8 UTSW 1 172,015,056 (GRCm39) intron probably benign
R5092:Dcaf8 UTSW 1 172,014,476 (GRCm39) missense probably benign 0.02
R5622:Dcaf8 UTSW 1 172,013,965 (GRCm39) intron probably benign
R5734:Dcaf8 UTSW 1 172,000,478 (GRCm39) missense possibly damaging 0.65
R6245:Dcaf8 UTSW 1 171,993,434 (GRCm39) start codon destroyed probably benign 0.01
R7090:Dcaf8 UTSW 1 172,016,535 (GRCm39) missense probably damaging 0.96
R8178:Dcaf8 UTSW 1 172,013,886 (GRCm39) missense probably benign 0.22
R8734:Dcaf8 UTSW 1 172,021,427 (GRCm39) missense probably benign 0.01
R8978:Dcaf8 UTSW 1 172,022,124 (GRCm39) missense probably benign 0.00
R8985:Dcaf8 UTSW 1 172,000,199 (GRCm39) missense probably benign
R9014:Dcaf8 UTSW 1 172,007,530 (GRCm39) missense possibly damaging 0.93
R9423:Dcaf8 UTSW 1 172,007,524 (GRCm39) missense probably damaging 1.00
R9500:Dcaf8 UTSW 1 171,999,909 (GRCm39) missense possibly damaging 0.63
Z1176:Dcaf8 UTSW 1 172,000,496 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GTTGGACATTTCACTTGCTCAG -3'
(R):5'- ACCATGTGTGTTTCCAAGTCAATG -3'

Sequencing Primer
(F):5'- CTCAGACTGTTTCCTGAGGTACAG -3'
(R):5'- GAGCACATACTCTTCTTGCAGAG -3'
Posted On 2014-06-23