Incidental Mutation 'R5030:Rffl'
ID391642
Institutional Source Beutler Lab
Gene Symbol Rffl
Ensembl Gene ENSMUSG00000020696
Gene Namering finger and FYVE like domain containing protein
Synonyms1700051E09Rik, Carp-2, 4930516L10Rik, rififylin, fring, Carp2
MMRRC Submission 042621-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5030 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82802449-82871210 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 82812717 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 127 (R127*)
Ref Sequence ENSEMBL: ENSMUSP00000115846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021036] [ENSMUST00000071152] [ENSMUST00000074515] [ENSMUST00000093975] [ENSMUST00000103218] [ENSMUST00000108173] [ENSMUST00000126660]
Predicted Effect probably null
Transcript: ENSMUST00000021036
AA Change: R92*
SMART Domains Protein: ENSMUSP00000021036
Gene: ENSMUSG00000020696
AA Change: R92*

DomainStartEndE-ValueType
PDB:1Y02|A 27 145 3e-75 PDB
Blast:RING 47 88 2e-19 BLAST
low complexity region 163 175 N/A INTRINSIC
RING 288 322 3.47e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000071152
AA Change: R127*
SMART Domains Protein: ENSMUSP00000071150
Gene: ENSMUSG00000020696
AA Change: R127*

DomainStartEndE-ValueType
PDB:1Y02|A 62 180 1e-74 PDB
Blast:RING 82 123 2e-19 BLAST
low complexity region 198 210 N/A INTRINSIC
RING 351 385 3.47e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000074515
AA Change: R92*
SMART Domains Protein: ENSMUSP00000074108
Gene: ENSMUSG00000020696
AA Change: R92*

DomainStartEndE-ValueType
PDB:1Y02|A 27 145 4e-75 PDB
Blast:RING 47 88 2e-19 BLAST
low complexity region 163 175 N/A INTRINSIC
RING 316 350 3.47e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093975
AA Change: R106*
SMART Domains Protein: ENSMUSP00000091510
Gene: ENSMUSG00000020696
AA Change: R106*

DomainStartEndE-ValueType
PDB:1Y02|A 41 159 6e-75 PDB
Blast:RING 61 102 2e-19 BLAST
low complexity region 177 189 N/A INTRINSIC
RING 330 364 3.47e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103218
AA Change: R92*
SMART Domains Protein: ENSMUSP00000099507
Gene: ENSMUSG00000020696
AA Change: R92*

DomainStartEndE-ValueType
PDB:1Y02|A 27 145 1e-76 PDB
SCOP:d1vfya_ 46 86 9e-5 SMART
Blast:RING 47 88 4e-20 BLAST
low complexity region 163 175 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108173
AA Change: R92*
SMART Domains Protein: ENSMUSP00000103808
Gene: ENSMUSG00000020696
AA Change: R92*

DomainStartEndE-ValueType
PDB:1Y02|A 27 145 4e-75 PDB
Blast:RING 47 88 2e-19 BLAST
low complexity region 163 175 N/A INTRINSIC
RING 316 350 3.47e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126660
AA Change: R127*
SMART Domains Protein: ENSMUSP00000115846
Gene: ENSMUSG00000020696
AA Change: R127*

DomainStartEndE-ValueType
PDB:1Y02|A 62 142 9e-50 PDB
SCOP:d1vfya_ 81 121 1e-3 SMART
Blast:RING 82 123 7e-21 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (87/89)
MGI Phenotype PHENOTYPE: Mice homozygous for an inactivating targeted mutation of this gene are born at the expected Mendelian frequency; they are viable and fertile and exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A C 5: 26,479,785 noncoding transcript Het
4932438A13Rik A G 3: 36,943,399 probably benign Het
9330182L06Rik T A 5: 9,428,502 N455K probably damaging Het
Abca15 A T 7: 120,340,001 E206V probably damaging Het
Acy1 A G 9: 106,433,397 F343L probably benign Het
Adam22 T C 5: 8,179,645 probably benign Het
Adgrv1 A T 13: 81,459,829 D4041E probably benign Het
Akr1c14 T C 13: 4,079,102 S166P probably damaging Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Atm A T 9: 53,520,109 Y316* probably null Het
Atp1a1 T C 3: 101,579,817 D892G probably benign Het
Auts2 A G 5: 131,443,498 V581A probably benign Het
Boll T A 1: 55,355,735 N57I probably damaging Het
C1s2 A C 6: 124,635,588 V36G possibly damaging Het
Capza1 T C 3: 104,840,838 Y70C probably damaging Het
Carnmt1 T C 19: 18,691,586 S292P possibly damaging Het
Cyp2g1 T G 7: 26,820,801 V486G probably benign Het
Dennd6b T A 15: 89,196,251 T49S possibly damaging Het
Dhx58 A T 11: 100,696,137 I610N probably damaging Het
Fam170a T A 18: 50,281,954 N222K probably benign Het
Fbn1 A G 2: 125,412,704 V213A possibly damaging Het
Frem3 A C 8: 80,613,247 D723A possibly damaging Het
Fsip2 A T 2: 82,988,492 K4856N possibly damaging Het
Galnt17 A G 5: 130,876,513 V571A probably damaging Het
Gm6124 A G 7: 39,223,030 noncoding transcript Het
Gm884 G A 11: 103,534,849 P1419S unknown Het
Gm8973 A G 15: 99,006,255 noncoding transcript Het
Gpd2 A G 2: 57,304,405 T107A probably damaging Het
Hsd17b11 G A 5: 104,003,292 A192V probably damaging Het
Igkv6-25 C T 6: 70,215,442 Q4* probably null Het
Kalrn A G 16: 33,975,742 I1221T probably benign Het
Klhl9 G T 4: 88,720,534 T490K possibly damaging Het
Lnpep A G 17: 17,579,309 V28A probably damaging Het
Man2c1 A G 9: 57,140,639 H843R probably benign Het
Map1b T C 13: 99,434,174 K680E unknown Het
Metap2 A T 10: 93,879,677 probably null Het
Mfsd2a A T 4: 122,950,156 I340N possibly damaging Het
Mgll T C 6: 88,818,665 probably null Het
Mum1 T C 10: 80,240,375 probably benign Het
Myh9 A G 15: 77,807,798 probably benign Het
Ncapd3 A T 9: 27,071,766 I937F probably damaging Het
Neb T C 2: 52,334,492 probably benign Het
Nova1 A G 12: 46,700,247 S416P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1395 A T 11: 49,148,361 M35L probably benign Het
Olfr502 T A 7: 108,523,177 I258F possibly damaging Het
Olfr869 A T 9: 20,138,067 K317M probably benign Het
Oosp3 T C 19: 11,700,944 W95R probably benign Het
Pcdha7 T A 18: 36,975,448 S509T probably damaging Het
Pdgfrb T C 18: 61,065,135 V296A probably benign Het
Pdzd2 A T 15: 12,592,408 L50* probably null Het
Plcl2 G T 17: 50,607,319 R452L possibly damaging Het
Poldip3 A T 15: 83,138,191 F131I possibly damaging Het
Sec24d T A 3: 123,358,901 V854E probably damaging Het
Sgo2a T A 1: 58,017,759 L1034* probably null Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
Spaca1 A T 4: 34,039,247 N95K possibly damaging Het
Spag17 C T 3: 100,085,341 Q1718* probably null Het
Spdl1 C T 11: 34,823,440 A141T probably benign Het
Stxbp3-ps A T 19: 9,558,350 noncoding transcript Het
Supv3l1 G T 10: 62,430,615 A594D probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tcrg-V7 G T 13: 19,178,388 L82F probably damaging Het
Tmem131 T C 1: 36,827,174 N483S possibly damaging Het
Tmem2 T G 19: 21,842,105 F1087V probably benign Het
Tonsl A T 15: 76,638,101 C231S probably damaging Het
Trav9n-4 T C 14: 53,294,848 F53S possibly damaging Het
Trim45 T G 3: 100,928,072 V457G probably damaging Het
Trpm1 T A 7: 64,235,831 I865N probably damaging Het
Trpm3 C A 19: 22,698,766 L99I probably benign Het
Twist1 T A 12: 33,958,441 L155Q probably damaging Het
Vac14 A G 8: 110,710,386 E577G possibly damaging Het
Vmn1r184 T C 7: 26,267,456 V209A probably benign Het
Xdh C T 17: 73,891,293 G1200R probably damaging Het
Zbbx C T 3: 75,083,683 D290N possibly damaging Het
Zbtb40 T C 4: 136,997,952 T585A probably benign Het
Zc3h4 T A 7: 16,422,230 D262E unknown Het
Zfp777 G T 6: 48,037,667 D368E probably damaging Het
Other mutations in Rffl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Rffl APN 11 82818484 missense probably damaging 1.00
IGL01120:Rffl APN 11 82806022 missense probably damaging 1.00
IGL01295:Rffl APN 11 82818457 missense probably damaging 1.00
IGL01635:Rffl APN 11 82812552 missense probably benign 0.00
R0127:Rffl UTSW 11 82812632 missense probably damaging 1.00
R0195:Rffl UTSW 11 82810163 missense probably damaging 1.00
R2125:Rffl UTSW 11 82818438 missense probably damaging 0.99
R5104:Rffl UTSW 11 82812793 nonsense probably null
R5283:Rffl UTSW 11 82812789 missense probably damaging 1.00
R5483:Rffl UTSW 11 82812723 synonymous probably null
R5828:Rffl UTSW 11 82818418 missense probably damaging 1.00
R5974:Rffl UTSW 11 82806151 missense probably damaging 1.00
R6651:Rffl UTSW 11 82812779 missense probably damaging 1.00
R6951:Rffl UTSW 11 82845750 critical splice donor site probably null
R7053:Rffl UTSW 11 82812671 missense probably null 1.00
R7587:Rffl UTSW 11 82810148 missense probably damaging 1.00
R7782:Rffl UTSW 11 82812769 nonsense probably null
RF009:Rffl UTSW 11 82845772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACAGAGGTGACTTGTGCAG -3'
(R):5'- CAAGAGCTACTGTAGGATGTCC -3'

Sequencing Primer
(F):5'- AGGAAGGCCTGCTGCTCAG -3'
(R):5'- AGGATGTCCTGCTGGCG -3'
Posted On2016-06-06