Incidental Mutation 'R5149:Ahsg'
ID395270
Institutional Source Beutler Lab
Gene Symbol Ahsg
Ensembl Gene ENSMUSG00000022868
Gene Namealpha-2-HS-glycoprotein
Synonymsfetuin-A
MMRRC Submission 042732-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5149 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22891277-22899449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22898923 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 245 (T245A)
Ref Sequence ENSEMBL: ENSMUSP00000156233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023583] [ENSMUST00000231328] [ENSMUST00000231848] [ENSMUST00000231932] [ENSMUST00000232098] [ENSMUST00000232674]
Predicted Effect probably benign
Transcript: ENSMUST00000023583
AA Change: T296A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023583
Gene: ENSMUSG00000022868
AA Change: T296A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 22 133 8.6e-24 SMART
CY 145 248 6.58e-20 SMART
low complexity region 273 288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231328
AA Change: T252A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231692
Predicted Effect probably benign
Transcript: ENSMUST00000231848
AA Change: T245A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000231932
Predicted Effect probably benign
Transcript: ENSMUST00000232098
AA Change: T217A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232556
Predicted Effect probably benign
Transcript: ENSMUST00000232674
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha2-HS glycoprotein (AHSG), a glycoprotein present in the serum, is synthesized by hepatocytes. The AHSG molecule consists of two polypeptide chains, which are both cleaved from a proprotein encoded from a single mRNA. It is involved in several functions, such as endocytosis, brain development and the formation of bone tissue. The protein is commonly present in the cortical plate of the immature cerebral cortex and bone marrow hemopoietic matrix, and it has therefore been postulated that it participates in the development of the tissues. However, its exact significance is still obscure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking this gene exhibit defective inhibition of serum apatite formation, sometimes causing muscle calcification. They are resistant to weight gain on a high-fat diet and have increased insulin sensitivity and glucose clearance and reduced fasting plasma free fatty acids and triglycerides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c13 G T 13: 4,194,169 V74L probably benign Het
Amt G A 9: 108,301,451 V389I possibly damaging Het
Ankrd26 T C 6: 118,558,996 N159S probably benign Het
Atp1a4 A G 1: 172,232,005 I840T probably damaging Het
Capn1 T C 19: 5,990,334 probably null Het
Col27a1 T C 4: 63,331,427 probably benign Het
Cyp2j5 A G 4: 96,659,507 L166P probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dchs1 G A 7: 105,755,658 T2559I probably damaging Het
Dnah12 C A 14: 26,850,926 S258* probably null Het
Dpep1 A T 8: 123,200,438 T309S probably benign Het
Epha5 A T 5: 84,150,358 F559L probably damaging Het
Gm3409 T C 5: 146,537,761 I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,612,179 probably benign Het
Gtf3c1 G T 7: 125,668,037 R941S probably damaging Het
Helb C T 10: 120,105,743 E347K probably benign Het
Ighv14-3 A G 12: 114,060,090 S36P probably damaging Het
Klrb1c T A 6: 128,783,707 M211L probably benign Het
Larp7 C T 3: 127,540,811 E510K probably damaging Het
Lrig1 C T 6: 94,628,044 R190Q possibly damaging Het
March6 A G 15: 31,461,994 S863P possibly damaging Het
Mgst2 A G 3: 51,682,537 N132S probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1138 A T 2: 87,737,405 S306R probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr804 T C 10: 129,705,508 V210A probably benign Het
Papln A T 12: 83,771,882 probably null Het
Poteg C T 8: 27,481,643 S395L possibly damaging Het
Prox1 T A 1: 190,147,053 I643F possibly damaging Het
Sept4 A G 11: 87,589,245 E211G probably damaging Het
Serpinb6e A G 13: 33,832,485 F422L probably damaging Het
Slc22a19 A G 19: 7,711,138 L19P probably damaging Het
Snf8 G T 11: 96,043,460 A136S probably benign Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spta1 A G 1: 174,247,434 T2409A probably damaging Het
Tat A G 8: 109,996,818 S313G probably benign Het
Tep1 A T 14: 50,837,398 C1785* probably null Het
Tmem132b A G 5: 125,622,925 S176G probably damaging Het
Tnfrsf8 T C 4: 145,303,105 R42G possibly damaging Het
Trio T C 15: 27,754,029 D2124G possibly damaging Het
Trp53bp1 A T 2: 121,216,117 D1067E probably benign Het
Tspan13 T C 12: 36,024,066 S24G probably damaging Het
Zdbf2 T C 1: 63,304,903 S814P possibly damaging Het
Zfp213 C A 17: 23,561,399 R49L probably damaging Het
Other mutations in Ahsg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01830:Ahsg APN 16 22899029 missense probably damaging 1.00
IGL01885:Ahsg APN 16 22898981 missense probably damaging 1.00
IGL02208:Ahsg APN 16 22892310 missense possibly damaging 0.89
IGL02593:Ahsg APN 16 22892328 critical splice donor site probably null
IGL03059:Ahsg APN 16 22899005 missense possibly damaging 0.57
R0257:Ahsg UTSW 16 22899040 missense probably benign
R0615:Ahsg UTSW 16 22899055 missense possibly damaging 0.92
R1829:Ahsg UTSW 16 22892328 unclassified probably benign
R5034:Ahsg UTSW 16 22898900 missense probably damaging 1.00
R5670:Ahsg UTSW 16 22898163 missense probably benign
R6264:Ahsg UTSW 16 22898861 missense probably benign 0.00
R6788:Ahsg UTSW 16 22894835 missense probably benign 0.01
R7026:Ahsg UTSW 16 22892213 missense probably damaging 1.00
R7027:Ahsg UTSW 16 22892257 missense probably damaging 0.99
X0060:Ahsg UTSW 16 22895262 missense probably damaging 1.00
Z1177:Ahsg UTSW 16 22899047 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACTGTAACCCACACTCATG -3'
(R):5'- GTCCTGTCTGCCAAAACCTTAC -3'

Sequencing Primer
(F):5'- GTCATGGAAAACCATCTTGCCTACTG -3'
(R):5'- TTACTTCCCCGAATCAAGCCTAG -3'
Posted On2016-06-21