Incidental Mutation 'R0452:Nisch'
ID39714
Institutional Source Beutler Lab
Gene Symbol Nisch
Ensembl Gene ENSMUSG00000021910
Gene Namenischarin
Synonyms1200007D05Rik, 3202002H23Rik
MMRRC Submission 038652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0452 (G1)
Quality Score179
Status Validated
Chromosome14
Chromosomal Location31170930-31216946 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to A at 31177464 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000022469] [ENSMUST00000167449] [ENSMUST00000168206] [ENSMUST00000169628] [ENSMUST00000169906]
Predicted Effect unknown
Transcript: ENSMUST00000022469
AA Change: N653I
SMART Domains Protein: ENSMUSP00000022469
Gene: ENSMUSG00000021910
AA Change: N653I

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
PDB:4PQ8|A 287 420 9e-8 PDB
SCOP:d1h6ta2 291 421 6e-29 SMART
Blast:LRR 311 332 5e-6 BLAST
Blast:LRR 333 355 6e-6 BLAST
Blast:LRR 378 403 5e-7 BLAST
Blast:LRR 403 429 6e-7 BLAST
low complexity region 489 501 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
coiled coil region 625 650 N/A INTRINSIC
low complexity region 662 695 N/A INTRINSIC
low complexity region 1038 1069 N/A INTRINSIC
low complexity region 1081 1193 N/A INTRINSIC
low complexity region 1491 1509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163552
SMART Domains Protein: ENSMUSP00000131689
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
low complexity region 96 127 N/A INTRINSIC
low complexity region 139 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167223
Predicted Effect probably benign
Transcript: ENSMUST00000167449
Predicted Effect unknown
Transcript: ENSMUST00000168206
AA Change: N408I
SMART Domains Protein: ENSMUSP00000132842
Gene: ENSMUSG00000021910
AA Change: N408I

DomainStartEndE-ValueType
Pfam:LRR_8 44 101 3.9e-9 PFAM
Pfam:LRR_1 45 66 2.6e-2 PFAM
Pfam:LRR_6 88 109 1.1e-2 PFAM
Pfam:LRR_4 89 132 6.5e-8 PFAM
Pfam:LRR_1 90 109 6.9e-2 PFAM
Blast:LRR 133 158 4e-7 BLAST
Blast:LRR 158 184 6e-7 BLAST
low complexity region 244 256 N/A INTRINSIC
low complexity region 272 289 N/A INTRINSIC
coiled coil region 380 405 N/A INTRINSIC
low complexity region 417 450 N/A INTRINSIC
low complexity region 793 824 N/A INTRINSIC
low complexity region 836 948 N/A INTRINSIC
low complexity region 1246 1264 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168451
SMART Domains Protein: ENSMUSP00000132912
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
Pfam:PX 4 53 5.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169628
SMART Domains Protein: ENSMUSP00000131465
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
low complexity region 231 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169906
SMART Domains Protein: ENSMUSP00000129268
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
coiled coil region 113 138 N/A INTRINSIC
low complexity region 150 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170253
SMART Domains Protein: ENSMUSP00000129547
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
SCOP:d1dcea3 2 86 3e-11 SMART
Blast:LRR 13 34 1e-5 BLAST
Blast:LRR 35 60 1e-7 BLAST
Blast:LRR 60 86 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170436
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 99% (93/94)
MGI Phenotype PHENOTYPE: Mice homozygous for either a knock-out or hypomorphic allele exhibit hearing loss associated with increased susceptibility to otitis media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A G 8: 106,507,190 probably benign Het
Acap3 C A 4: 155,902,328 S347* probably null Het
Acvr1 G A 2: 58,500,495 P19L probably benign Het
Add2 G T 6: 86,104,629 E366* probably null Het
Ankrd28 C A 14: 31,748,738 A153S probably damaging Het
Anxa8 A T 14: 34,094,770 I206F probably damaging Het
Arhgef4 G A 1: 34,732,322 E1237K probably damaging Het
Arid1a C T 4: 133,689,105 A1120T unknown Het
Atad5 T C 11: 80,106,421 V857A probably damaging Het
Atp2a3 T A 11: 72,977,232 probably null Het
Atxn1l C T 8: 109,732,395 V412I possibly damaging Het
Card11 A G 5: 140,880,370 S923P probably benign Het
Cars C A 7: 143,592,625 E21* probably null Het
Ccdc115 A G 1: 34,437,621 probably benign Het
Ccnj T A 19: 40,845,064 probably null Het
Cds2 C T 2: 132,298,479 T182I probably damaging Het
Ceacam14 A G 7: 17,815,323 H213R probably benign Het
Cfap44 A T 16: 44,431,945 M806L probably benign Het
Chd8 A T 14: 52,214,587 I1317K probably damaging Het
Cherp A T 8: 72,461,522 probably benign Het
Creb5 C G 6: 53,604,542 T30S possibly damaging Het
Csf2ra A G 19: 61,226,895 M94T probably benign Het
Cyp2b19 A C 7: 26,766,762 D330A probably benign Het
Ddost G A 4: 138,310,188 V188M possibly damaging Het
Dnah7a A T 1: 53,605,819 D1019E probably benign Het
Dtx1 A T 5: 120,694,992 I127N possibly damaging Het
Dyrk2 T C 10: 118,868,763 T3A possibly damaging Het
Elovl5 C T 9: 77,960,911 T35M probably damaging Het
Emc7 T C 2: 112,466,969 probably benign Het
Erp27 T C 6: 136,909,489 Y182C probably damaging Het
Exoc2 T A 13: 30,886,327 probably benign Het
F5 A C 1: 164,185,107 D530A probably damaging Het
Fam149a A T 8: 45,355,649 V149E probably damaging Het
Fbxo41 A G 6: 85,478,182 S614P probably damaging Het
Fmn1 T A 2: 113,636,779 Y1342N possibly damaging Het
Gm10334 A G 6: 41,445,337 Y45H probably benign Het
Gpr22 T A 12: 31,708,794 D443V possibly damaging Het
Il17rd T A 14: 27,091,931 W56R probably damaging Het
Itga2b A T 11: 102,465,953 probably null Het
Jmjd1c T C 10: 67,255,482 M2514T probably benign Het
Klk9 T C 7: 43,794,251 probably benign Het
Krr1 T C 10: 111,975,598 Y66H probably damaging Het
Lamb2 T C 9: 108,486,354 probably benign Het
Lgals3bp A T 11: 118,393,464 Y430N probably benign Het
Lrp10 T C 14: 54,467,579 V113A probably benign Het
Mgam A G 6: 40,759,090 Y841C probably damaging Het
Nlrp4d G A 7: 10,378,292 T650I probably benign Het
Olfr1314 T A 2: 112,092,636 K22* probably null Het
Olfr506 C T 7: 108,612,370 T21I possibly damaging Het
Parp4 A G 14: 56,648,843 D1793G unknown Het
Pcm1 A G 8: 41,325,905 D1850G probably benign Het
Pgap2 G A 7: 102,236,462 A145T probably damaging Het
Phc1 G A 6: 122,323,036 A583V probably damaging Het
Plcd3 G A 11: 103,071,259 probably benign Het
Ppm1m T A 9: 106,197,302 Q214L probably damaging Het
Prkg2 A G 5: 98,997,520 probably benign Het
Rasal3 T C 17: 32,395,817 probably benign Het
Rfc1 A T 5: 65,264,297 D1086E probably benign Het
Rnf145 T A 11: 44,561,760 L522H probably damaging Het
Setd2 T A 9: 110,553,100 probably null Het
Sik1 C A 17: 31,849,081 V377F possibly damaging Het
Slc44a4 T C 17: 34,928,095 I367T possibly damaging Het
Slfn3 A G 11: 83,213,128 D275G possibly damaging Het
Smarcad1 A T 6: 65,074,822 N313I possibly damaging Het
Smc4 A T 3: 69,008,028 K138* probably null Het
Smg6 T A 11: 74,930,213 S437T probably benign Het
Spaca9 G T 2: 28,695,993 Q20K probably damaging Het
Spatc1 T G 15: 76,268,293 I41S probably damaging Het
Spink5 A T 18: 43,963,318 T5S possibly damaging Het
St3gal1 C A 15: 67,109,655 probably benign Het
Stat5a C A 11: 100,863,135 T97K probably benign Het
Stat5b A T 11: 100,798,330 I246N probably benign Het
Supt6 G T 11: 78,227,003 D462E probably damaging Het
Swi5 A T 2: 32,281,824 probably benign Het
Syne1 A T 10: 5,405,435 V375E probably damaging Het
Tcp1 T C 17: 12,924,352 F516S probably benign Het
Tdrd7 A T 4: 45,965,488 probably benign Het
Tgfbr3 A T 5: 107,140,423 N457K probably benign Het
Tmem209 A G 6: 30,487,381 M500T probably damaging Het
Tmem44 C T 16: 30,517,463 probably benign Het
Ttc21a T A 9: 119,939,154 probably benign Het
Ttn T A 2: 76,836,003 I88F possibly damaging Het
Ttn A G 2: 76,871,110 probably benign Het
Ube2w T C 1: 16,602,255 probably benign Het
Ufc1 C T 1: 171,289,954 probably benign Het
Uhmk1 A G 1: 170,212,402 M132T possibly damaging Het
Usp29 A G 7: 6,963,182 N675D possibly damaging Het
Vmn1r23 A G 6: 57,926,484 V103A possibly damaging Het
Wdr59 G T 8: 111,521,972 R4S possibly damaging Het
Zc3hav1 T A 6: 38,307,437 E914D probably benign Het
Other mutations in Nisch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Nisch APN 14 31176639 unclassified probably benign
IGL01934:Nisch APN 14 31176739 unclassified probably benign
IGL02201:Nisch APN 14 31187094 unclassified probably benign
IGL02964:Nisch APN 14 31180812 unclassified probably benign
IGL03340:Nisch APN 14 31173144 missense probably damaging 0.98
R0092:Nisch UTSW 14 31191453 unclassified probably benign
R0119:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0196:Nisch UTSW 14 31203394 unclassified probably benign
R0299:Nisch UTSW 14 31171924 missense probably damaging 1.00
R1529:Nisch UTSW 14 31180938 unclassified probably benign
R1643:Nisch UTSW 14 31173168 missense probably damaging 1.00
R1656:Nisch UTSW 14 31177271 unclassified probably benign
R1663:Nisch UTSW 14 31191521 unclassified probably benign
R1676:Nisch UTSW 14 31180902 unclassified probably benign
R1750:Nisch UTSW 14 31174882 unclassified probably benign
R1799:Nisch UTSW 14 31177271 unclassified probably benign
R1824:Nisch UTSW 14 31176432 unclassified probably benign
R1876:Nisch UTSW 14 31173637 missense probably damaging 1.00
R2107:Nisch UTSW 14 31172140 missense probably damaging 0.99
R2117:Nisch UTSW 14 31177285 unclassified probably benign
R2276:Nisch UTSW 14 31176846 unclassified probably benign
R2402:Nisch UTSW 14 31185014 intron probably benign
R3703:Nisch UTSW 14 31176745 unclassified probably benign
R3704:Nisch UTSW 14 31176745 unclassified probably benign
R3705:Nisch UTSW 14 31176745 unclassified probably benign
R3897:Nisch UTSW 14 31191000 unclassified probably benign
R4024:Nisch UTSW 14 31176819 unclassified probably benign
R4412:Nisch UTSW 14 31186658 intron probably benign
R4752:Nisch UTSW 14 31192588 missense probably damaging 1.00
R4832:Nisch UTSW 14 31177630 utr 3 prime probably benign
R5009:Nisch UTSW 14 31187229 unclassified probably benign
R5043:Nisch UTSW 14 31176465 unclassified probably benign
R5062:Nisch UTSW 14 31172440 missense probably damaging 0.99
R5254:Nisch UTSW 14 31206567 splice site probably null
R5754:Nisch UTSW 14 31191416 unclassified probably benign
R5906:Nisch UTSW 14 31172028 intron probably null
R5930:Nisch UTSW 14 31173145 missense probably benign 0.11
R6246:Nisch UTSW 14 31172559 missense probably damaging 1.00
R6258:Nisch UTSW 14 31177128 unclassified probably benign
R6260:Nisch UTSW 14 31177128 unclassified probably benign
R6327:Nisch UTSW 14 31171487 utr 3 prime probably benign
R6671:Nisch UTSW 14 31204463 unclassified probably benign
R6874:Nisch UTSW 14 31176684 unclassified probably benign
R6887:Nisch UTSW 14 31185344 unclassified probably benign
R7273:Nisch UTSW 14 31174407 missense unknown
R7401:Nisch UTSW 14 31206580 missense probably benign 0.18
R7423:Nisch UTSW 14 31171701 missense probably benign 0.09
R7822:Nisch UTSW 14 31174651 unclassified probably benign
R7870:Nisch UTSW 14 31172095 missense probably damaging 1.00
R7887:Nisch UTSW 14 31176695 nonsense probably null
R7953:Nisch UTSW 14 31172095 missense probably damaging 1.00
R7970:Nisch UTSW 14 31176695 nonsense probably null
X0027:Nisch UTSW 14 31187084 unclassified probably benign
Z1177:Nisch UTSW 14 31177438 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCCGAAGTCAGTGAGCACAAG -3'
(R):5'- GATCATGCAGAGCCAGAGGTTCAG -3'

Sequencing Primer
(F):5'- CGTGGATCAGGAAGCACC -3'
(R):5'- CACTTGCATTGGCTACACAG -3'
Posted On2013-05-23