Incidental Mutation 'R0452:Lamb2'
ID39698
Institutional Source Beutler Lab
Gene Symbol Lamb2
Ensembl Gene ENSMUSG00000052911
Gene Namelaminin, beta 2
SynonymsLams, npht, Lamb-2
MMRRC Submission 038652-MU
Accession Numbers

Genbank: NM_008483; MGI: 99916

Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock #R0452 (G1)
Quality Score223
Status Validated
Chromosome9
Chromosomal Location108479736-108490530 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 108486354 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000065014] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]
Predicted Effect probably benign
Transcript: ENSMUST00000006854
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065014
SMART Domains Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 284 1.9e-102 SMART
EGF_Lam 286 347 1.34e-6 SMART
EGF_Lam 350 410 6.1e-10 SMART
EGF_Lam 413 470 2.98e-13 SMART
EGF_Lam 473 522 7.93e-9 SMART
EGF_Lam 525 569 1.01e-10 SMART
EGF_Lam 784 829 3.42e-13 SMART
EGF_Lam 832 875 6.54e-10 SMART
EGF_Lam 878 925 1.34e-6 SMART
EGF_Lam 928 984 4.74e-7 SMART
EGF_Lam 987 1036 1.53e-10 SMART
EGF_Lam 1039 1093 6.29e-12 SMART
EGF_Lam 1096 1141 1.79e-7 SMART
EGF_Lam 1144 1188 6.64e-11 SMART
coiled coil region 1261 1299 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
coiled coil region 1473 1527 N/A INTRINSIC
low complexity region 1609 1625 N/A INTRINSIC
SCOP:d1eq1a_ 1632 1786 5e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085044
SMART Domains Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 4.7e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 2.5e-15 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 524 530 N/A INTRINSIC
Pfam:UCH 538 1253 7.4e-84 PFAM
Pfam:UCH_1 539 879 2.3e-13 PFAM
Pfam:zf-MYND 833 875 2.4e-10 PFAM
Pfam:UCH_1 1020 1235 2.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166103
SMART Domains Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 2.6e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 390 3.9e-9 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 500 506 N/A INTRINSIC
Pfam:UCH 514 1229 1.8e-84 PFAM
Pfam:UCH_1 515 855 5.5e-14 PFAM
Pfam:zf-MYND 809 851 1.7e-10 PFAM
Pfam:UCH_1 996 1211 6.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178075
SMART Domains Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1e-6 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 5.4e-15 PFAM
low complexity region 450 461 N/A INTRINSIC
low complexity region 525 531 N/A INTRINSIC
Pfam:UCH 539 1254 4.9e-84 PFAM
Pfam:UCH_1 540 880 1.4e-13 PFAM
Pfam:zf-MYND 834 876 5.2e-10 PFAM
Pfam:UCH_1 1021 1236 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193301
Predicted Effect probably benign
Transcript: ENSMUST00000193678
SMART Domains Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 6.8e-7 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 3.6e-15 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 523 529 N/A INTRINSIC
Pfam:UCH 537 1252 3.8e-84 PFAM
Pfam:UCH_1 538 878 1.1e-13 PFAM
Pfam:zf-MYND 832 874 5.1e-10 PFAM
Pfam:UCH_1 1019 1234 1.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194421
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 99% (93/94)
MGI Phenotype Strain: 2138070
Lethality: D1-D30
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit small size, severe proteinuria due to a defect in glomerular filtration, abnormalities of the retina and skeletal neuromuscular synapses, and lethality by 30 days of age. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A G 8: 106,507,190 probably benign Het
Acap3 C A 4: 155,902,328 S347* probably null Het
Acvr1 G A 2: 58,500,495 P19L probably benign Het
Add2 G T 6: 86,104,629 E366* probably null Het
Ankrd28 C A 14: 31,748,738 A153S probably damaging Het
Anxa8 A T 14: 34,094,770 I206F probably damaging Het
Arhgef4 G A 1: 34,732,322 E1237K probably damaging Het
Arid1a C T 4: 133,689,105 A1120T unknown Het
Atad5 T C 11: 80,106,421 V857A probably damaging Het
Atp2a3 T A 11: 72,977,232 probably null Het
Atxn1l C T 8: 109,732,395 V412I possibly damaging Het
Card11 A G 5: 140,880,370 S923P probably benign Het
Cars C A 7: 143,592,625 E21* probably null Het
Ccdc115 A G 1: 34,437,621 probably benign Het
Ccnj T A 19: 40,845,064 probably null Het
Cds2 C T 2: 132,298,479 T182I probably damaging Het
Ceacam14 A G 7: 17,815,323 H213R probably benign Het
Cfap44 A T 16: 44,431,945 M806L probably benign Het
Chd8 A T 14: 52,214,587 I1317K probably damaging Het
Cherp A T 8: 72,461,522 probably benign Het
Creb5 C G 6: 53,604,542 T30S possibly damaging Het
Csf2ra A G 19: 61,226,895 M94T probably benign Het
Cyp2b19 A C 7: 26,766,762 D330A probably benign Het
Ddost G A 4: 138,310,188 V188M possibly damaging Het
Dnah7a A T 1: 53,605,819 D1019E probably benign Het
Dtx1 A T 5: 120,694,992 I127N possibly damaging Het
Dyrk2 T C 10: 118,868,763 T3A possibly damaging Het
Elovl5 C T 9: 77,960,911 T35M probably damaging Het
Emc7 T C 2: 112,466,969 probably benign Het
Erp27 T C 6: 136,909,489 Y182C probably damaging Het
Exoc2 T A 13: 30,886,327 probably benign Het
F5 A C 1: 164,185,107 D530A probably damaging Het
Fam149a A T 8: 45,355,649 V149E probably damaging Het
Fbxo41 A G 6: 85,478,182 S614P probably damaging Het
Fmn1 T A 2: 113,636,779 Y1342N possibly damaging Het
Gm10334 A G 6: 41,445,337 Y45H probably benign Het
Gpr22 T A 12: 31,708,794 D443V possibly damaging Het
Il17rd T A 14: 27,091,931 W56R probably damaging Het
Itga2b A T 11: 102,465,953 probably null Het
Jmjd1c T C 10: 67,255,482 M2514T probably benign Het
Klk9 T C 7: 43,794,251 probably benign Het
Krr1 T C 10: 111,975,598 Y66H probably damaging Het
Lgals3bp A T 11: 118,393,464 Y430N probably benign Het
Lrp10 T C 14: 54,467,579 V113A probably benign Het
Mgam A G 6: 40,759,090 Y841C probably damaging Het
Nisch T A 14: 31,177,464 probably benign Het
Nlrp4d G A 7: 10,378,292 T650I probably benign Het
Olfr1314 T A 2: 112,092,636 K22* probably null Het
Olfr506 C T 7: 108,612,370 T21I possibly damaging Het
Parp4 A G 14: 56,648,843 D1793G unknown Het
Pcm1 A G 8: 41,325,905 D1850G probably benign Het
Pgap2 G A 7: 102,236,462 A145T probably damaging Het
Phc1 G A 6: 122,323,036 A583V probably damaging Het
Plcd3 G A 11: 103,071,259 probably benign Het
Ppm1m T A 9: 106,197,302 Q214L probably damaging Het
Prkg2 A G 5: 98,997,520 probably benign Het
Rasal3 T C 17: 32,395,817 probably benign Het
Rfc1 A T 5: 65,264,297 D1086E probably benign Het
Rnf145 T A 11: 44,561,760 L522H probably damaging Het
Setd2 T A 9: 110,553,100 probably null Het
Sik1 C A 17: 31,849,081 V377F possibly damaging Het
Slc44a4 T C 17: 34,928,095 I367T possibly damaging Het
Slfn3 A G 11: 83,213,128 D275G possibly damaging Het
Smarcad1 A T 6: 65,074,822 N313I possibly damaging Het
Smc4 A T 3: 69,008,028 K138* probably null Het
Smg6 T A 11: 74,930,213 S437T probably benign Het
Spaca9 G T 2: 28,695,993 Q20K probably damaging Het
Spatc1 T G 15: 76,268,293 I41S probably damaging Het
Spink5 A T 18: 43,963,318 T5S possibly damaging Het
St3gal1 C A 15: 67,109,655 probably benign Het
Stat5a C A 11: 100,863,135 T97K probably benign Het
Stat5b A T 11: 100,798,330 I246N probably benign Het
Supt6 G T 11: 78,227,003 D462E probably damaging Het
Swi5 A T 2: 32,281,824 probably benign Het
Syne1 A T 10: 5,405,435 V375E probably damaging Het
Tcp1 T C 17: 12,924,352 F516S probably benign Het
Tdrd7 A T 4: 45,965,488 probably benign Het
Tgfbr3 A T 5: 107,140,423 N457K probably benign Het
Tmem209 A G 6: 30,487,381 M500T probably damaging Het
Tmem44 C T 16: 30,517,463 probably benign Het
Ttc21a T A 9: 119,939,154 probably benign Het
Ttn T A 2: 76,836,003 I88F possibly damaging Het
Ttn A G 2: 76,871,110 probably benign Het
Ube2w T C 1: 16,602,255 probably benign Het
Ufc1 C T 1: 171,289,954 probably benign Het
Uhmk1 A G 1: 170,212,402 M132T possibly damaging Het
Usp29 A G 7: 6,963,182 N675D possibly damaging Het
Vmn1r23 A G 6: 57,926,484 V103A possibly damaging Het
Wdr59 G T 8: 111,521,972 R4S possibly damaging Het
Zc3hav1 T A 6: 38,307,437 E914D probably benign Het
Other mutations in Lamb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Lamb2 APN 9 108487733 unclassified probably null
IGL02072:Lamb2 APN 9 108481908 nonsense probably null
IGL02079:Lamb2 APN 9 108482113 missense probably damaging 1.00
IGL02087:Lamb2 APN 9 108487119 missense possibly damaging 0.95
IGL02193:Lamb2 APN 9 108489360 missense probably benign 0.00
IGL02199:Lamb2 APN 9 108480625 missense possibly damaging 0.49
IGL02201:Lamb2 APN 9 108487542 missense probably damaging 1.00
IGL02468:Lamb2 APN 9 108487149 missense probably damaging 1.00
F6893:Lamb2 UTSW 9 108482556 missense probably benign 0.12
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0122:Lamb2 UTSW 9 108486514 missense probably benign 0.01
R0524:Lamb2 UTSW 9 108484372 missense possibly damaging 0.90
R0605:Lamb2 UTSW 9 108486105 unclassified probably benign
R0737:Lamb2 UTSW 9 108483794 missense probably benign 0.03
R1083:Lamb2 UTSW 9 108483693 missense probably benign
R1159:Lamb2 UTSW 9 108481408 missense probably damaging 1.00
R1283:Lamb2 UTSW 9 108481808 missense possibly damaging 0.46
R1507:Lamb2 UTSW 9 108490382 missense probably damaging 1.00
R1547:Lamb2 UTSW 9 108482625 missense probably benign 0.00
R1576:Lamb2 UTSW 9 108480307 missense probably damaging 0.96
R1647:Lamb2 UTSW 9 108481423 critical splice donor site probably null
R1678:Lamb2 UTSW 9 108483686 critical splice acceptor site probably null
R1740:Lamb2 UTSW 9 108481928 missense probably damaging 1.00
R1803:Lamb2 UTSW 9 108488099 missense probably benign
R1846:Lamb2 UTSW 9 108487387 missense probably benign 0.00
R1863:Lamb2 UTSW 9 108481384 missense probably benign 0.13
R2184:Lamb2 UTSW 9 108480553 missense probably damaging 1.00
R2262:Lamb2 UTSW 9 108480610 missense probably damaging 1.00
R2338:Lamb2 UTSW 9 108482141 missense probably benign 0.20
R2483:Lamb2 UTSW 9 108480559 missense probably damaging 1.00
R4084:Lamb2 UTSW 9 108488018 missense probably benign 0.17
R4164:Lamb2 UTSW 9 108490298 missense probably damaging 1.00
R4295:Lamb2 UTSW 9 108486211 missense probably benign 0.42
R4422:Lamb2 UTSW 9 108483555 missense probably damaging 0.99
R4497:Lamb2 UTSW 9 108486798 missense probably damaging 1.00
R4880:Lamb2 UTSW 9 108484027 unclassified probably null
R4935:Lamb2 UTSW 9 108487501 missense possibly damaging 0.93
R4977:Lamb2 UTSW 9 108487647 missense probably damaging 0.99
R5152:Lamb2 UTSW 9 108487738 missense probably benign
R5499:Lamb2 UTSW 9 108487802 missense possibly damaging 0.50
R5724:Lamb2 UTSW 9 108480751 splice site probably null
R5932:Lamb2 UTSW 9 108480611 missense probably damaging 1.00
R5997:Lamb2 UTSW 9 108480388 missense possibly damaging 0.65
R6052:Lamb2 UTSW 9 108487612 nonsense probably null
R6142:Lamb2 UTSW 9 108485618 nonsense probably null
R6245:Lamb2 UTSW 9 108488199 splice site probably null
R6531:Lamb2 UTSW 9 108483726 missense possibly damaging 0.78
R6557:Lamb2 UTSW 9 108488400 missense probably damaging 1.00
R6562:Lamb2 UTSW 9 108487008 missense possibly damaging 0.56
R6997:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7024:Lamb2 UTSW 9 108489488 missense probably benign 0.00
R7116:Lamb2 UTSW 9 108487323 missense probably damaging 1.00
R7146:Lamb2 UTSW 9 108484084 missense possibly damaging 0.94
R7261:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7288:Lamb2 UTSW 9 108488324 missense probably benign 0.20
R7404:Lamb2 UTSW 9 108487583 missense probably damaging 1.00
R7456:Lamb2 UTSW 9 108485780 missense possibly damaging 0.95
R7472:Lamb2 UTSW 9 108486148 missense probably benign 0.01
R7623:Lamb2 UTSW 9 108489224 missense possibly damaging 0.62
Z1176:Lamb2 UTSW 9 108482901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGCTGTGACCACTGTCAACG -3'
(R):5'- AGCCCTGTCCAGTCAAGAGGAAAC -3'

Sequencing Primer
(F):5'- TGAGTGTGATACCCACACAG -3'
(R):5'- ATATCCATCCCGGTGGCAAG -3'
Posted On2013-05-23