Incidental Mutation 'R0452:Rasal3'
Institutional Source Beutler Lab
Gene Symbol Rasal3
Ensembl Gene ENSMUSG00000052142
Gene NameRAS protein activator like 3
MMRRC Submission 038652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0452 (G1)
Quality Score225
Status Validated
Chromosomal Location32390659-32403583 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 32395817 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063824] [ENSMUST00000135618] [ENSMUST00000136375] [ENSMUST00000137458]
Predicted Effect probably benign
Transcript: ENSMUST00000063824
SMART Domains Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142

low complexity region 57 72 N/A INTRINSIC
low complexity region 120 137 N/A INTRINSIC
PH 165 323 3.94e0 SMART
Blast:RasGAP 354 381 9e-8 BLAST
low complexity region 385 402 N/A INTRINSIC
RasGAP 433 755 2.03e-81 SMART
low complexity region 826 839 N/A INTRINSIC
coiled coil region 932 1013 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135560
Predicted Effect probably benign
Transcript: ENSMUST00000135618
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142

low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135968
Predicted Effect probably benign
Transcript: ENSMUST00000136375
SMART Domains Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142

low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 7e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
Pfam:RasGAP 483 579 6.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137458
SMART Domains Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142

low complexity region 35 50 N/A INTRINSIC
low complexity region 119 140 N/A INTRINSIC
PH 167 325 3.94e0 SMART
Blast:RasGAP 356 383 9e-8 BLAST
low complexity region 387 404 N/A INTRINSIC
RasGAP 435 757 2.03e-81 SMART
low complexity region 828 841 N/A INTRINSIC
coiled coil region 934 1015 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143808
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras GTPase-activating proteins (RasGAP) family and encodes a protein with pleckstrin homology (PH), C2, and Ras GTPase-activation protein (RasGAP) domains. This protein is localized near or at the plasma membrane when expressed exogenously. Reduced expression of this gene in some cell lines resulted in increased levels of the active form of Ras (Ras-GTP), suggesting that this gene may play a role in negatively regulating the Ras signaling pathway. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced NT T cells in the liver, increased granulocytes in the bone marrow and decreased susceptibility to alpha-GalCer-induced liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A G 8: 106,507,190 probably benign Het
Acap3 C A 4: 155,902,328 S347* probably null Het
Acvr1 G A 2: 58,500,495 P19L probably benign Het
Add2 G T 6: 86,104,629 E366* probably null Het
Ankrd28 C A 14: 31,748,738 A153S probably damaging Het
Anxa8 A T 14: 34,094,770 I206F probably damaging Het
Arhgef4 G A 1: 34,732,322 E1237K probably damaging Het
Arid1a C T 4: 133,689,105 A1120T unknown Het
Atad5 T C 11: 80,106,421 V857A probably damaging Het
Atp2a3 T A 11: 72,977,232 probably null Het
Atxn1l C T 8: 109,732,395 V412I possibly damaging Het
Card11 A G 5: 140,880,370 S923P probably benign Het
Cars C A 7: 143,592,625 E21* probably null Het
Ccdc115 A G 1: 34,437,621 probably benign Het
Ccnj T A 19: 40,845,064 probably null Het
Cds2 C T 2: 132,298,479 T182I probably damaging Het
Ceacam14 A G 7: 17,815,323 H213R probably benign Het
Cfap44 A T 16: 44,431,945 M806L probably benign Het
Chd8 A T 14: 52,214,587 I1317K probably damaging Het
Cherp A T 8: 72,461,522 probably benign Het
Creb5 C G 6: 53,604,542 T30S possibly damaging Het
Csf2ra A G 19: 61,226,895 M94T probably benign Het
Cyp2b19 A C 7: 26,766,762 D330A probably benign Het
Ddost G A 4: 138,310,188 V188M possibly damaging Het
Dnah7a A T 1: 53,605,819 D1019E probably benign Het
Dtx1 A T 5: 120,694,992 I127N possibly damaging Het
Dyrk2 T C 10: 118,868,763 T3A possibly damaging Het
Elovl5 C T 9: 77,960,911 T35M probably damaging Het
Emc7 T C 2: 112,466,969 probably benign Het
Erp27 T C 6: 136,909,489 Y182C probably damaging Het
Exoc2 T A 13: 30,886,327 probably benign Het
F5 A C 1: 164,185,107 D530A probably damaging Het
Fam149a A T 8: 45,355,649 V149E probably damaging Het
Fbxo41 A G 6: 85,478,182 S614P probably damaging Het
Fmn1 T A 2: 113,636,779 Y1342N possibly damaging Het
Gm10334 A G 6: 41,445,337 Y45H probably benign Het
Gpr22 T A 12: 31,708,794 D443V possibly damaging Het
Il17rd T A 14: 27,091,931 W56R probably damaging Het
Itga2b A T 11: 102,465,953 probably null Het
Jmjd1c T C 10: 67,255,482 M2514T probably benign Het
Klk9 T C 7: 43,794,251 probably benign Het
Krr1 T C 10: 111,975,598 Y66H probably damaging Het
Lamb2 T C 9: 108,486,354 probably benign Het
Lgals3bp A T 11: 118,393,464 Y430N probably benign Het
Lrp10 T C 14: 54,467,579 V113A probably benign Het
Mgam A G 6: 40,759,090 Y841C probably damaging Het
Nisch T A 14: 31,177,464 probably benign Het
Nlrp4d G A 7: 10,378,292 T650I probably benign Het
Olfr1314 T A 2: 112,092,636 K22* probably null Het
Olfr506 C T 7: 108,612,370 T21I possibly damaging Het
Parp4 A G 14: 56,648,843 D1793G unknown Het
Pcm1 A G 8: 41,325,905 D1850G probably benign Het
Pgap2 G A 7: 102,236,462 A145T probably damaging Het
Phc1 G A 6: 122,323,036 A583V probably damaging Het
Plcd3 G A 11: 103,071,259 probably benign Het
Ppm1m T A 9: 106,197,302 Q214L probably damaging Het
Prkg2 A G 5: 98,997,520 probably benign Het
Rfc1 A T 5: 65,264,297 D1086E probably benign Het
Rnf145 T A 11: 44,561,760 L522H probably damaging Het
Setd2 T A 9: 110,553,100 probably null Het
Sik1 C A 17: 31,849,081 V377F possibly damaging Het
Slc44a4 T C 17: 34,928,095 I367T possibly damaging Het
Slfn3 A G 11: 83,213,128 D275G possibly damaging Het
Smarcad1 A T 6: 65,074,822 N313I possibly damaging Het
Smc4 A T 3: 69,008,028 K138* probably null Het
Smg6 T A 11: 74,930,213 S437T probably benign Het
Spaca9 G T 2: 28,695,993 Q20K probably damaging Het
Spatc1 T G 15: 76,268,293 I41S probably damaging Het
Spink5 A T 18: 43,963,318 T5S possibly damaging Het
St3gal1 C A 15: 67,109,655 probably benign Het
Stat5a C A 11: 100,863,135 T97K probably benign Het
Stat5b A T 11: 100,798,330 I246N probably benign Het
Supt6 G T 11: 78,227,003 D462E probably damaging Het
Swi5 A T 2: 32,281,824 probably benign Het
Syne1 A T 10: 5,405,435 V375E probably damaging Het
Tcp1 T C 17: 12,924,352 F516S probably benign Het
Tdrd7 A T 4: 45,965,488 probably benign Het
Tgfbr3 A T 5: 107,140,423 N457K probably benign Het
Tmem209 A G 6: 30,487,381 M500T probably damaging Het
Tmem44 C T 16: 30,517,463 probably benign Het
Ttc21a T A 9: 119,939,154 probably benign Het
Ttn T A 2: 76,836,003 I88F possibly damaging Het
Ttn A G 2: 76,871,110 probably benign Het
Ube2w T C 1: 16,602,255 probably benign Het
Ufc1 C T 1: 171,289,954 probably benign Het
Uhmk1 A G 1: 170,212,402 M132T possibly damaging Het
Usp29 A G 7: 6,963,182 N675D possibly damaging Het
Vmn1r23 A G 6: 57,926,484 V103A possibly damaging Het
Wdr59 G T 8: 111,521,972 R4S possibly damaging Het
Zc3hav1 T A 6: 38,307,437 E914D probably benign Het
Other mutations in Rasal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Rasal3 APN 17 32397405 missense possibly damaging 0.89
IGL02291:Rasal3 APN 17 32393737 unclassified probably benign
IGL02346:Rasal3 APN 17 32399349 missense probably damaging 1.00
IGL02422:Rasal3 APN 17 32398973 missense probably benign 0.11
Beaten UTSW 17 32391344 missense probably benign 0.05
bent UTSW 17 32396781 missense probably damaging 1.00
bowed UTSW 17 32396790 missense probably damaging 1.00
kinked UTSW 17 32396350 nonsense probably null
R0057:Rasal3 UTSW 17 32391383 missense probably benign 0.00
R0133:Rasal3 UTSW 17 32403383 start codon destroyed probably null 0.89
R0180:Rasal3 UTSW 17 32399405 missense probably benign
R0403:Rasal3 UTSW 17 32392790 splice site probably null
R0600:Rasal3 UTSW 17 32393526 missense probably damaging 0.99
R0760:Rasal3 UTSW 17 32392172 missense probably benign 0.00
R1438:Rasal3 UTSW 17 32393535 splice site probably null
R1669:Rasal3 UTSW 17 32403098 missense possibly damaging 0.81
R1914:Rasal3 UTSW 17 32396350 nonsense probably null
R1928:Rasal3 UTSW 17 32397353 missense probably damaging 1.00
R2002:Rasal3 UTSW 17 32393611 missense probably damaging 1.00
R3053:Rasal3 UTSW 17 32403439 missense probably benign 0.03
R3770:Rasal3 UTSW 17 32392151 missense probably damaging 0.99
R3870:Rasal3 UTSW 17 32393548 missense possibly damaging 0.94
R4491:Rasal3 UTSW 17 32391385 missense probably damaging 0.99
R4783:Rasal3 UTSW 17 32396781 missense probably damaging 1.00
R4788:Rasal3 UTSW 17 32399338 missense probably benign 0.00
R4903:Rasal3 UTSW 17 32397383 missense probably damaging 1.00
R5185:Rasal3 UTSW 17 32396790 missense probably damaging 1.00
R5372:Rasal3 UTSW 17 32391344 missense probably benign 0.05
R5433:Rasal3 UTSW 17 32393601 missense probably benign 0.00
R5472:Rasal3 UTSW 17 32396669 missense probably damaging 1.00
R5920:Rasal3 UTSW 17 32395169 missense probably damaging 1.00
R6436:Rasal3 UTSW 17 32397504 missense probably damaging 1.00
R6837:Rasal3 UTSW 17 32403070 missense probably benign 0.17
R7047:Rasal3 UTSW 17 32396484 missense probably damaging 1.00
R7109:Rasal3 UTSW 17 32392709 missense probably damaging 1.00
R7179:Rasal3 UTSW 17 32392417 missense probably damaging 0.99
R7571:Rasal3 UTSW 17 32395861 missense possibly damaging 0.76
R7768:Rasal3 UTSW 17 32396793 missense probably damaging 0.96
R7874:Rasal3 UTSW 17 32396707 missense possibly damaging 0.75
R8155:Rasal3 UTSW 17 32397407 missense possibly damaging 0.93
R8265:Rasal3 UTSW 17 32395820 critical splice donor site probably null
R8544:Rasal3 UTSW 17 32392119 missense probably benign
R8677:Rasal3 UTSW 17 32396854 missense probably benign 0.03
R8695:Rasal3 UTSW 17 32392762 missense possibly damaging 0.93
RF004:Rasal3 UTSW 17 32391107 missense probably damaging 1.00
X0027:Rasal3 UTSW 17 32391219 missense probably damaging 1.00
X0027:Rasal3 UTSW 17 32392526 missense probably benign 0.00
X0065:Rasal3 UTSW 17 32403286 missense probably damaging 1.00
Z1177:Rasal3 UTSW 17 32399310 missense probably benign 0.06
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gagtcatcagtgaggaaggag -3'
Posted On2013-05-23