Incidental Mutation 'R5187:Rpain'
ID397973
Institutional Source Beutler Lab
Gene Symbol Rpain
Ensembl Gene ENSMUSG00000018449
Gene NameRPA interacting protein
Synonyms
MMRRC Submission 042766-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R5187 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70970213-70977833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70973832 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 115 (D115G)
Ref Sequence ENSEMBL: ENSMUSP00000136592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018593] [ENSMUST00000035283] [ENSMUST00000078528] [ENSMUST00000108529] [ENSMUST00000108530] [ENSMUST00000108531] [ENSMUST00000154430] [ENSMUST00000167509] [ENSMUST00000169965] [ENSMUST00000171254] [ENSMUST00000178822]
Predicted Effect probably benign
Transcript: ENSMUST00000018593
AA Change: D115G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018593
Gene: ENSMUSG00000018449
AA Change: D115G

DomainStartEndE-ValueType
Pfam:RPA_interact_N 8 47 1.7e-21 PFAM
Pfam:RPA_interact_M 59 127 1.1e-14 PFAM
Pfam:RPA_interact_C 136 217 2.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035283
SMART Domains Protein: ENSMUSP00000048101
Gene: ENSMUSG00000040667

DomainStartEndE-ValueType
Pfam:Nup88 13 752 1.1e-306 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078528
SMART Domains Protein: ENSMUSP00000077612
Gene: ENSMUSG00000018446

DomainStartEndE-ValueType
Pfam:MAM33 84 276 1.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108529
SMART Domains Protein: ENSMUSP00000104169
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 7.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108530
SMART Domains Protein: ENSMUSP00000104170
Gene: ENSMUSG00000040667

DomainStartEndE-ValueType
Pfam:Nup88 11 742 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108531
SMART Domains Protein: ENSMUSP00000104171
Gene: ENSMUSG00000040667

DomainStartEndE-ValueType
Pfam:Nup88 11 747 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151608
Predicted Effect probably benign
Transcript: ENSMUST00000154430
SMART Domains Protein: ENSMUSP00000137113
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 38 1.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155371
Predicted Effect probably benign
Transcript: ENSMUST00000167509
AA Change: D115G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127315
Gene: ENSMUSG00000018449
AA Change: D115G

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 2.7e-23 PFAM
Pfam:RPA_interact_M 58 128 5.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169965
SMART Domains Protein: ENSMUSP00000128903
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 1e-23 PFAM
Pfam:RPA_interact_M 58 106 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171254
SMART Domains Protein: ENSMUSP00000133243
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 1.1e-23 PFAM
Pfam:RPA_interact_M 58 107 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178253
Predicted Effect probably benign
Transcript: ENSMUST00000178822
AA Change: D115G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136592
Gene: ENSMUSG00000018449
AA Change: D115G

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 2.7e-23 PFAM
Pfam:RPA_interact_M 58 128 5.3e-16 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,718,809 L620* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcg5 A G 17: 84,658,564 L628S probably damaging Het
Acbd3 C T 1: 180,736,732 R201* probably null Het
Adsl A G 15: 80,948,905 probably benign Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cachd1 T C 4: 100,966,200 V483A possibly damaging Het
Calm1 T C 12: 100,200,213 S19P probably benign Het
Casq1 T C 1: 172,213,074 N313S possibly damaging Het
Cav2 G T 6: 17,286,936 A64S possibly damaging Het
Ccdc114 A G 7: 45,929,116 I77V probably damaging Het
Ccdc167 C A 17: 29,705,511 A39S possibly damaging Het
Cd274 T C 19: 29,382,536 L247P probably benign Het
Cdhr5 T C 7: 141,274,448 E138G probably damaging Het
Cltb C T 13: 54,593,880 C81Y probably benign Het
Clvs1 T C 4: 9,281,865 L103P possibly damaging Het
Cntrob G T 11: 69,321,891 Q106K possibly damaging Het
Ctsh T C 9: 90,054,590 L14P probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Cyb5r4 T C 9: 87,026,948 V26A possibly damaging Het
Ddx18 A G 1: 121,562,128 I184T probably damaging Het
Ddx60 T A 8: 61,974,188 W766R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah5 G A 15: 28,272,172 V1041I probably benign Het
Dnajc21 A T 15: 10,463,964 N38K probably benign Het
Ermap T C 4: 119,185,818 probably null Het
Fam129a T A 1: 151,703,829 L433Q possibly damaging Het
Fryl A G 5: 73,086,600 L1209P possibly damaging Het
Gm5093 T C 17: 46,439,873 E76G possibly damaging Het
Grk6 T C 13: 55,451,706 C169R probably damaging Het
Hmgn1 A T 16: 96,122,427 probably null Het
Lpcat2b T A 5: 107,434,135 Y443* probably null Het
Macf1 T A 4: 123,472,089 M1395L probably benign Het
Mllt10 C T 2: 18,208,774 Q997* probably null Het
Mocos T A 18: 24,692,554 V722E probably damaging Het
Moxd2 A T 6: 40,879,337 L534M probably benign Het
Mphosph10 T C 7: 64,385,820 M368V possibly damaging Het
Myo15 G A 11: 60,503,614 G2383D probably damaging Het
Myo5b T C 18: 74,701,674 I935T possibly damaging Het
Ndst4 T A 3: 125,437,911 L43H probably damaging Het
Nsl1 A G 1: 191,075,190 N189D probably benign Het
Olfr558 A T 7: 102,709,661 H134L probably damaging Het
Pcdh8 T C 14: 79,770,154 D323G probably damaging Het
Pkhd1 A G 1: 20,209,224 S2957P possibly damaging Het
Prdm9 T G 17: 15,562,893 E42D probably damaging Het
Rasal1 C A 5: 120,675,395 H611Q probably benign Het
Rif1 T A 2: 52,081,289 W260R probably damaging Het
Rpl3l T C 17: 24,732,455 V110A possibly damaging Het
Ryr2 T A 13: 11,772,452 I1012F probably damaging Het
Sema4f A G 6: 82,917,650 V480A probably benign Het
Slc35a3 T A 3: 116,681,145 K199N probably damaging Het
Slc5a6 T C 5: 31,042,978 Y121C probably damaging Het
Slc7a14 T C 3: 31,237,365 probably null Het
Sort1 T A 3: 108,324,676 I172N probably damaging Het
Spink5 C A 18: 43,989,451 H328N probably damaging Het
Tbl1xr1 A G 3: 22,209,606 D504G probably damaging Het
Tcaf3 C T 6: 42,597,020 C86Y possibly damaging Het
Tfap2e T C 4: 126,734,641 D174G probably benign Het
Tmem42 T C 9: 123,022,167 V65A probably damaging Het
Vmn1r225 C G 17: 20,502,915 T206R probably damaging Het
Vmn2r38 A G 7: 9,097,572 F65S probably benign Het
Vmn2r87 A T 10: 130,497,339 L14Q probably null Het
Xirp2 T C 2: 67,515,367 S2651P probably benign Het
Zfp429 G A 13: 67,390,840 L162F probably damaging Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Other mutations in Rpain
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Rpain APN 11 70970532 missense possibly damaging 0.71
R0962:Rpain UTSW 11 70975041 critical splice donor site probably null
R1529:Rpain UTSW 11 70974915 missense probably damaging 1.00
R4010:Rpain UTSW 11 70973007 splice site probably benign
R4950:Rpain UTSW 11 70970921 missense probably benign 0.00
R5420:Rpain UTSW 11 70977690 unclassified probably null
R7190:Rpain UTSW 11 70971909 missense possibly damaging 0.82
R7650:Rpain UTSW 11 70970445 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTAGAGTACAGTTCTGCATCTC -3'
(R):5'- CTTCCGGTCAATAAACTGGGTG -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- TCAATAAACTGGGTGTGGGG -3'
Posted On2016-07-06