Incidental Mutation 'R5513:Mcm4'
ID440196
Institutional Source Beutler Lab
Gene Symbol Mcm4
Ensembl Gene ENSMUSG00000022673
Gene Nameminichromosome maintenance complex component 4
SynonymsmCdc21, 19G, Cdc21, Mcmd4
MMRRC Submission 043073-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5513 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location15623897-15637400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15630514 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 393 (Y393F)
Ref Sequence ENSEMBL: ENSMUSP00000023353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023353]
Predicted Effect probably benign
Transcript: ENSMUST00000023353
AA Change: Y393F

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023353
Gene: ENSMUSG00000022673
AA Change: Y393F

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
MCM 266 769 N/A SMART
AAA 501 653 7.04e-3 SMART
Blast:MCM 781 849 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000229606
Predicted Effect probably benign
Transcript: ENSMUST00000230437
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this allele cause chromosomal instability as assessed by micronucleus levels in erythrocytes. Mice homozygous for a spontaneous allele exhibit early onset T cell acute lymphoblastic leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,750,973 V1130I probably damaging Het
Abtb2 A T 2: 103,709,278 probably null Het
Akr1b3 C A 6: 34,316,646 probably benign Het
Alppl2 T A 1: 87,087,338 N434Y probably benign Het
Ampd2 A G 3: 108,075,667 I648T possibly damaging Het
Ankrd11 T C 8: 122,892,520 E1510G probably benign Het
Ano2 A C 6: 126,039,322 K939N possibly damaging Het
Arhgef5 A G 6: 43,272,339 Y8C probably damaging Het
Aspm A T 1: 139,482,398 I2609F probably damaging Het
Camsap2 A T 1: 136,280,863 S964T probably benign Het
Cd22 C T 7: 30,867,025 R823Q probably damaging Het
Cd74 T C 18: 60,811,305 C196R probably damaging Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Cidec A T 6: 113,428,179 Y177N probably damaging Het
Crb1 C T 1: 139,236,821 probably null Het
Cts7 T C 13: 61,355,584 K189E possibly damaging Het
Cyp2c68 A T 19: 39,703,406 Y358N probably damaging Het
Dab2ip A T 2: 35,710,254 H294L probably benign Het
Dnah6 T C 6: 73,190,419 D502G probably null Het
Dnah8 T A 17: 30,752,916 M2768K probably damaging Het
Etl4 C A 2: 20,743,827 S405R probably damaging Het
Fsip2 G T 2: 82,950,908 L19F probably damaging Het
Fsip2 T A 2: 82,985,198 N3758K possibly damaging Het
Fsip2 C G 2: 82,950,912 Q217E probably benign Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Hivep2 A T 10: 14,132,673 K1672* probably null Het
Igkv2-137 G A 6: 67,556,014 G54S possibly damaging Het
Ints8 A G 4: 11,248,303 V105A possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Lrrc8b A G 5: 105,485,984 K774R probably damaging Het
Mki67 A G 7: 135,707,750 L324P probably damaging Het
Olfr12 T C 1: 92,620,380 V158A probably benign Het
Olfr1428 A G 19: 12,109,381 L55P probably damaging Het
Olfr1441 G A 19: 12,422,683 V125I probably benign Het
Olfr665 A T 7: 104,881,499 H264L probably damaging Het
Pld4 A G 12: 112,762,554 E19G probably benign Het
Plvap T C 8: 71,511,529 E63G probably damaging Het
Ppig A G 2: 69,750,359 T746A probably benign Het
Prdm2 GCTCCTCCTCCTCCTCCTCCTCCTC GCTCCTCCTCCTCCTCCTCCTC 4: 143,135,893 probably benign Het
Rbm15b A G 9: 106,886,117 L284P probably benign Het
Rhbdl3 T C 11: 80,331,842 V239A probably damaging Het
Sae1 T C 7: 16,366,856 E197G probably benign Het
Sdhaf2 C T 19: 10,517,030 R105H probably damaging Het
Senp3 T C 11: 69,677,139 D425G probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc46a1 T C 11: 78,466,550 F143S probably benign Het
Tom1 T A 8: 75,057,220 N52K probably damaging Het
Vmn1r11 A T 6: 57,137,632 T94S probably damaging Het
Zfp236 A G 18: 82,658,022 I390T probably damaging Het
Zfp709 A T 8: 71,890,056 H443L probably damaging Het
Zfp960 C T 17: 17,087,734 P237S possibly damaging Het
Other mutations in Mcm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Mcm4 APN 16 15626131 missense probably damaging 1.00
IGL01982:Mcm4 APN 16 15630420 missense possibly damaging 0.57
IGL02382:Mcm4 APN 16 15624738 missense probably damaging 1.00
PIT4687001:Mcm4 UTSW 16 15636713 missense probably benign 0.01
R0200:Mcm4 UTSW 16 15629639 missense probably benign 0.41
R0540:Mcm4 UTSW 16 15632115 critical splice donor site probably null
R0607:Mcm4 UTSW 16 15632115 critical splice donor site probably null
R2064:Mcm4 UTSW 16 15634469 missense possibly damaging 0.75
R4240:Mcm4 UTSW 16 15627706 nonsense probably null
R4604:Mcm4 UTSW 16 15629663 missense probably damaging 1.00
R4871:Mcm4 UTSW 16 15634510 nonsense probably null
R5070:Mcm4 UTSW 16 15625570 missense probably damaging 1.00
R5125:Mcm4 UTSW 16 15635303 missense probably benign 0.21
R5178:Mcm4 UTSW 16 15635303 missense probably benign 0.21
R5245:Mcm4 UTSW 16 15630425 missense probably benign 0.02
R5696:Mcm4 UTSW 16 15625570 missense probably damaging 1.00
R6453:Mcm4 UTSW 16 15630409 missense probably damaging 1.00
R6753:Mcm4 UTSW 16 15629362 missense possibly damaging 0.91
R6909:Mcm4 UTSW 16 15628697 missense probably damaging 1.00
R6937:Mcm4 UTSW 16 15636335 missense probably benign
R7402:Mcm4 UTSW 16 15637178 start codon destroyed probably null
R7483:Mcm4 UTSW 16 15630442 missense probably benign 0.05
R8275:Mcm4 UTSW 16 15634571 missense probably damaging 0.98
Z1177:Mcm4 UTSW 16 15629454 missense probably damaging 1.00
Z1177:Mcm4 UTSW 16 15632216 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATCTGGCTTCCTGGAAAGTTC -3'
(R):5'- AGCTCATACAACACAGATGGTTAC -3'

Sequencing Primer
(F):5'- AGTTCCTTAAGCAATTTCACACG -3'
(R):5'- GGGTCTGTTCTTAAAAACCTGTG -3'
Posted On2016-11-08