Incidental Mutation 'R5309:Gfm2'
ID404740
Institutional Source Beutler Lab
Gene Symbol Gfm2
Ensembl Gene ENSMUSG00000021666
Gene NameG elongation factor, mitochondrial 2
SynonymsEFG2, MST027, A930009M04Rik, 6530419G12Rik
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location97137937-97181195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97163151 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 406 (A406T)
Ref Sequence ENSEMBL: ENSMUSP00000048373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022170] [ENSMUST00000042084] [ENSMUST00000161639] [ENSMUST00000161825] [ENSMUST00000161913]
Predicted Effect probably damaging
Transcript: ENSMUST00000022170
AA Change: A431T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022170
Gene: ENSMUSG00000021666
AA Change: A431T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 66 349 9.9e-64 PFAM
Pfam:GTP_EFTU_D2 379 446 4.3e-8 PFAM
low complexity region 447 473 N/A INTRINSIC
Pfam:EFG_II 482 556 3.9e-29 PFAM
EFG_IV 558 677 2.94e-17 SMART
EFG_C 679 766 1.9e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000042084
AA Change: A406T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048373
Gene: ENSMUSG00000021666
AA Change: A406T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 324 4.6e-64 PFAM
Pfam:GTP_EFTU_D2 354 421 4.2e-8 PFAM
low complexity region 422 448 N/A INTRINSIC
Pfam:EFG_II 457 531 3.7e-29 PFAM
EFG_IV 533 652 2.94e-17 SMART
EFG_C 654 741 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160989
Predicted Effect probably damaging
Transcript: ENSMUST00000161639
AA Change: A433T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125656
Gene: ENSMUSG00000021666
AA Change: A433T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 1.2e-68 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 4.5e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 768 1.9e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161825
AA Change: A433T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125088
Gene: ENSMUSG00000021666
AA Change: A433T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 2.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 1.1e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 7.1e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 738 3.46e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161843
Predicted Effect probably damaging
Transcript: ENSMUST00000161913
AA Change: A433T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124253
Gene: ENSMUSG00000021666
AA Change: A433T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 3.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 3.2e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 532 2.1e-13 PFAM
Meta Mutation Damage Score 0.456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors, which is a GTPase that plays a role at the termination of mitochondrial translation by mediating the disassembly of ribosomes from messenger RNA . Its role in the regulation of normal mitochondrial function and in disease states attributed to mitochondrial dysfunction is not known. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Gfm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gfm2 APN 13 97155442 missense probably benign 0.38
IGL00781:Gfm2 APN 13 97149339 missense probably damaging 1.00
IGL00789:Gfm2 APN 13 97173058 unclassified probably benign
IGL00978:Gfm2 APN 13 97162977 missense probably benign 0.20
IGL01637:Gfm2 APN 13 97150409 missense probably damaging 1.00
IGL02318:Gfm2 APN 13 97162975 missense probably damaging 1.00
R0825:Gfm2 UTSW 13 97143104 splice site probably benign
R1173:Gfm2 UTSW 13 97165200 splice site probably null
R1847:Gfm2 UTSW 13 97162934 missense probably benign 0.04
R1932:Gfm2 UTSW 13 97141967 missense probably damaging 0.96
R2104:Gfm2 UTSW 13 97171520 missense probably damaging 0.99
R2108:Gfm2 UTSW 13 97155442 missense probably benign 0.38
R2877:Gfm2 UTSW 13 97153249 missense possibly damaging 0.80
R2878:Gfm2 UTSW 13 97153249 missense possibly damaging 0.80
R2898:Gfm2 UTSW 13 97172961 missense possibly damaging 0.85
R3931:Gfm2 UTSW 13 97175024 missense probably benign 0.02
R4011:Gfm2 UTSW 13 97143100 splice site probably benign
R4831:Gfm2 UTSW 13 97165038 missense probably damaging 1.00
R4921:Gfm2 UTSW 13 97175676 missense probably damaging 0.99
R5182:Gfm2 UTSW 13 97162893 missense probably damaging 1.00
R5310:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5311:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5339:Gfm2 UTSW 13 97175040 missense probably benign
R5594:Gfm2 UTSW 13 97165038 missense probably damaging 1.00
R5599:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R6014:Gfm2 UTSW 13 97151661 intron probably null
R6041:Gfm2 UTSW 13 97172623 missense probably benign 0.11
R6108:Gfm2 UTSW 13 97149422 missense possibly damaging 0.79
R6345:Gfm2 UTSW 13 97162953 missense probably damaging 0.96
R6596:Gfm2 UTSW 13 97165149 missense probably damaging 1.00
R6937:Gfm2 UTSW 13 97163064 splice site probably null
R6958:Gfm2 UTSW 13 97146236 missense probably damaging 1.00
R6996:Gfm2 UTSW 13 97149360 missense probably damaging 1.00
R7291:Gfm2 UTSW 13 97175024 missense probably benign 0.02
R7365:Gfm2 UTSW 13 97143021 missense probably benign 0.06
R7456:Gfm2 UTSW 13 97145703 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTGTCCACAACATTAATAGAAACTG -3'
(R):5'- AATCCATCCTGTCTGTGGGC -3'

Sequencing Primer
(F):5'- CTGCACGTAAGGAAAAGGTTTGC -3'
(R):5'- ATCCTGTCTGTGGGCTTCTGTAATC -3'
Posted On2016-07-22