Incidental Mutation 'R5320:Krt18'
ID406084
Institutional Source Beutler Lab
Gene Symbol Krt18
Ensembl Gene ENSMUSG00000023043
Gene Namekeratin 18
SynonymsEndo B, K18, CK18, Krt1-18
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102028180-102032027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102028520 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 81 (D81V)
Ref Sequence ENSEMBL: ENSMUSP00000023803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023803]
Predicted Effect probably damaging
Transcript: ENSMUST00000023803
AA Change: D81V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023803
Gene: ENSMUSG00000023043
AA Change: D81V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 30 68 N/A INTRINSIC
Filament 71 384 3.69e-166 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KRT18 encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable, fertile, and live normal life spans. They do, however, develop hepatomegaly by 18 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Krt18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Krt18 APN 15 102030922 missense probably benign 0.07
IGL02666:Krt18 APN 15 102029867 missense probably damaging 1.00
PIT4378001:Krt18 UTSW 15 102029923 missense probably benign 0.20
R0077:Krt18 UTSW 15 102030974 missense probably benign 0.01
R0650:Krt18 UTSW 15 102029485 missense possibly damaging 0.60
R0651:Krt18 UTSW 15 102029485 missense possibly damaging 0.60
R0947:Krt18 UTSW 15 102030728 missense possibly damaging 0.57
R1015:Krt18 UTSW 15 102031300 missense probably benign 0.00
R1219:Krt18 UTSW 15 102031288 splice site probably benign
R1328:Krt18 UTSW 15 102030734 missense probably benign 0.00
R2051:Krt18 UTSW 15 102029500 missense probably benign 0.19
R2082:Krt18 UTSW 15 102031020 splice site probably null
R3735:Krt18 UTSW 15 102028501 missense probably benign 0.39
R4696:Krt18 UTSW 15 102031858 missense probably benign 0.12
R5211:Krt18 UTSW 15 102031453 missense probably damaging 0.97
R5805:Krt18 UTSW 15 102031300 missense probably benign 0.40
R6736:Krt18 UTSW 15 102030769 missense probably benign 0.38
R7221:Krt18 UTSW 15 102029532 missense possibly damaging 0.66
R7543:Krt18 UTSW 15 102031461 missense probably damaging 0.99
R7873:Krt18 UTSW 15 102030956 missense probably benign 0.06
R7883:Krt18 UTSW 15 102028450 missense possibly damaging 0.63
R8837:Krt18 UTSW 15 102029830 missense possibly damaging 0.50
X0064:Krt18 UTSW 15 102029962 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGCTTCACAACTCGCTCC -3'
(R):5'- CTGGATAGACAGAACAGCCC -3'

Sequencing Primer
(F):5'- TCTGTGCGAACTCCCAGC -3'
(R):5'- TAGACAGAACAGCCCGGAGC -3'
Posted On2016-07-22