Incidental Mutation 'R5320:Cap2'
ID 406076
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene Name cyclase associated actin cytoskeleton regulatory protein 2
Synonyms 2810452G09Rik
MMRRC Submission 042903-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5320 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 46655379-46803757 bp(+) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) A to G at 46801840 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 422 (*422W)
Ref Sequence ENSEMBL: ENSMUSP00000153125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
AlphaFold Q9CYT6
Predicted Effect probably null
Transcript: ENSMUST00000021802
AA Change: *477W
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: *477W

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119341
AA Change: *365W
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373
AA Change: *365W

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126687
Predicted Effect probably null
Transcript: ENSMUST00000225824
AA Change: *422W
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,526,541 (GRCm39) I581N probably damaging Het
Abcb10 A G 8: 124,697,763 (GRCm39) F187S probably benign Het
Actl11 T A 9: 107,808,203 (GRCm39) V842E possibly damaging Het
Akap12 A G 10: 4,307,291 (GRCm39) D1367G probably benign Het
Aoc1l1 T A 6: 48,952,474 (GRCm39) L133Q probably damaging Het
Aoc1l3 T A 6: 48,964,509 (GRCm39) F172L probably benign Het
AU040320 A T 4: 126,717,509 (GRCm39) H362L possibly damaging Het
Bmpr1a C T 14: 34,146,999 (GRCm39) V258M probably damaging Het
Bptf T A 11: 106,972,193 (GRCm39) K892* probably null Het
Cars2 G T 8: 11,567,854 (GRCm39) H414N probably benign Het
Ccnt1 A C 15: 98,442,124 (GRCm39) S381R probably benign Het
Cdyl2 A T 8: 117,321,794 (GRCm39) C244* probably null Het
Cers2 A G 3: 95,228,305 (GRCm39) E115G probably null Het
Cpt1b G A 15: 89,303,477 (GRCm39) P553S probably benign Het
Cuedc1 A G 11: 88,068,136 (GRCm39) E128G probably damaging Het
Dll4 T A 2: 119,156,968 (GRCm39) V80D probably damaging Het
Dop1b T C 16: 93,536,874 (GRCm39) L113P probably damaging Het
Fam98a A G 17: 75,845,810 (GRCm39) I312T probably damaging Het
Gnrhr T G 5: 86,345,473 (GRCm39) K71T possibly damaging Het
Gtf3c3 A T 1: 54,445,032 (GRCm39) L674Q probably damaging Het
Hipk2 A T 6: 38,795,212 (GRCm39) H352Q probably damaging Het
Hivep1 T C 13: 42,313,115 (GRCm39) V1785A probably damaging Het
Hspa4 A T 11: 53,153,810 (GRCm39) I687N probably damaging Het
Krt18 A T 15: 101,936,955 (GRCm39) D81V probably damaging Het
Lama3 A C 18: 12,685,912 (GRCm39) D1142A probably damaging Het
Lnpep A G 17: 17,766,727 (GRCm39) I713T possibly damaging Het
Man2b2 T A 5: 36,967,677 (GRCm39) Y897F probably damaging Het
Muc5b A T 7: 141,412,738 (GRCm39) I1895F unknown Het
Myh8 G A 11: 67,177,089 (GRCm39) V414I probably damaging Het
Myo1d A T 11: 80,575,149 (GRCm39) probably null Het
Nav2 A T 7: 49,141,121 (GRCm39) M889L probably benign Het
Oc90 C T 15: 65,754,457 (GRCm39) G236D probably benign Het
Or13a27 A G 7: 139,925,548 (GRCm39) V118A probably benign Het
Pak4 A G 7: 28,267,631 (GRCm39) I11T probably damaging Het
Papss2 T C 19: 32,615,787 (GRCm39) I173T probably damaging Het
Pcsk9 A T 4: 106,320,988 (GRCm39) D40E probably benign Het
Pdzrn3 G C 6: 101,128,064 (GRCm39) H867Q probably damaging Het
Plcb1 A T 2: 135,094,696 (GRCm39) I174F possibly damaging Het
Pom121l2 G A 13: 22,166,015 (GRCm39) W95* probably null Het
Prcp A T 7: 92,577,843 (GRCm39) T336S probably benign Het
Prdm11 A C 2: 92,843,226 (GRCm39) S78A probably benign Het
Ralgds T C 2: 28,435,224 (GRCm39) I405T probably damaging Het
Rasgrf1 A G 9: 89,902,478 (GRCm39) R1208G probably damaging Het
Rasgrp2 T A 19: 6,458,864 (GRCm39) probably null Het
Rb1 A T 14: 73,450,566 (GRCm39) Y599* probably null Het
Rnf141 A T 7: 110,433,010 (GRCm39) F62L probably damaging Het
Rsl24d1 T A 9: 73,023,698 (GRCm39) F292I possibly damaging Het
Scn10a C T 9: 119,477,175 (GRCm39) V736I probably damaging Het
Sim2 A T 16: 93,905,598 (GRCm39) T141S probably benign Het
Slc6a15 G T 10: 103,244,067 (GRCm39) V436L probably damaging Het
Smarca2 T C 19: 26,668,772 (GRCm39) S924P probably damaging Het
Tacc1 T C 8: 25,671,881 (GRCm39) E449G probably benign Het
Tlr3 A T 8: 45,852,137 (GRCm39) N253K possibly damaging Het
Tmem198 G A 1: 75,456,500 (GRCm39) A82T probably benign Het
Tom1l2 A T 11: 60,133,648 (GRCm39) L54* probably null Het
Trav12-2 A G 14: 53,854,356 (GRCm39) Y110C probably benign Het
Trdn T A 10: 33,209,247 (GRCm39) probably null Het
Trim36 G T 18: 46,300,565 (GRCm39) P690Q probably damaging Het
Trpc4 A T 3: 54,206,599 (GRCm39) M600L probably damaging Het
Trpm2 T A 10: 77,759,355 (GRCm39) Q1143L probably benign Het
Usp34 T A 11: 23,283,739 (GRCm39) D144E probably benign Het
Vps18 A T 2: 119,127,858 (GRCm39) R894* probably null Het
Vwa1 A G 4: 155,855,369 (GRCm39) V248A probably benign Het
Wdr75 T C 1: 45,838,211 (GRCm39) V40A probably damaging Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46,793,425 (GRCm39) splice site probably benign
IGL01927:Cap2 APN 13 46,789,109 (GRCm39) missense probably benign 0.03
IGL02213:Cap2 APN 13 46,789,087 (GRCm39) splice site probably benign
IGL02511:Cap2 APN 13 46,684,498 (GRCm39) start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46,678,968 (GRCm39) missense probably benign 0.00
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0385:Cap2 UTSW 13 46,714,023 (GRCm39) missense probably damaging 1.00
R0387:Cap2 UTSW 13 46,713,992 (GRCm39) missense probably damaging 0.99
R0712:Cap2 UTSW 13 46,768,837 (GRCm39) splice site probably null
R1489:Cap2 UTSW 13 46,763,111 (GRCm39) missense probably damaging 1.00
R1666:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1668:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1676:Cap2 UTSW 13 46,791,335 (GRCm39) missense probably damaging 1.00
R1756:Cap2 UTSW 13 46,684,489 (GRCm39) missense probably benign 0.11
R1822:Cap2 UTSW 13 46,768,823 (GRCm39) missense probably benign 0.03
R1867:Cap2 UTSW 13 46,793,555 (GRCm39) missense probably damaging 1.00
R1972:Cap2 UTSW 13 46,791,375 (GRCm39) missense probably damaging 0.98
R1990:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46,713,978 (GRCm39) critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46,793,317 (GRCm39) missense probably benign 0.20
R4024:Cap2 UTSW 13 46,791,317 (GRCm39) splice site probably benign
R4554:Cap2 UTSW 13 46,789,250 (GRCm39) missense probably damaging 1.00
R4748:Cap2 UTSW 13 46,793,302 (GRCm39) missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46,763,586 (GRCm39) missense probably damaging 0.99
R4876:Cap2 UTSW 13 46,684,497 (GRCm39) start codon destroyed probably null
R4902:Cap2 UTSW 13 46,684,501 (GRCm39) missense probably damaging 0.99
R5666:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R5670:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R6086:Cap2 UTSW 13 46,789,188 (GRCm39) missense probably damaging 1.00
R6728:Cap2 UTSW 13 46,793,335 (GRCm39) missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46,800,101 (GRCm39) missense probably damaging 1.00
R7785:Cap2 UTSW 13 46,789,224 (GRCm39) missense probably benign
R7889:Cap2 UTSW 13 46,800,051 (GRCm39) missense probably damaging 0.99
R8065:Cap2 UTSW 13 46,791,337 (GRCm39) missense probably damaging 1.00
R8205:Cap2 UTSW 13 46,768,739 (GRCm39) missense probably damaging 1.00
R8425:Cap2 UTSW 13 46,763,208 (GRCm39) missense probably damaging 0.98
R8731:Cap2 UTSW 13 46,800,006 (GRCm39) missense probably benign 0.00
R8738:Cap2 UTSW 13 46,684,548 (GRCm39) missense probably benign 0.00
R9320:Cap2 UTSW 13 46,768,818 (GRCm39) missense probably benign 0.04
R9491:Cap2 UTSW 13 46,791,366 (GRCm39) missense possibly damaging 0.92
R9686:Cap2 UTSW 13 46,678,926 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCGCCCATTGCATGACAC -3'
(R):5'- CGTGTTTACTAGTTATCACGTGGAAG -3'

Sequencing Primer
(F):5'- CACATGATCCTTCAATGTGTCTGCAG -3'
(R):5'- GTTATCACGTGGAAGTAAAATCACAC -3'
Posted On 2016-07-22