Incidental Mutation 'R5320:Oc90'
ID406081
Institutional Source Beutler Lab
Gene Symbol Oc90
Ensembl Gene ENSMUSG00000015001
Gene Nameotoconin 90
SynonymsPla2ll, PLA2L, Ocn-95
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location65876053-65912397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65882608 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 236 (G236D)
Ref Sequence ENSEMBL: ENSMUSP00000078709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060522] [ENSMUST00000079776]
Predicted Effect probably benign
Transcript: ENSMUST00000060522
AA Change: G269D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000062865
Gene: ENSMUSG00000015001
AA Change: G269D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 74 190 1.75e-15 SMART
PA2c 314 429 3.5e-15 SMART
low complexity region 446 458 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079776
AA Change: G236D

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078709
Gene: ENSMUSG00000015001
AA Change: G236D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 74 190 1.75e-15 SMART
PA2c 282 397 3.5e-15 SMART
low complexity region 414 426 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135442
AA Change: G113D
SMART Domains Protein: ENSMUSP00000114254
Gene: ENSMUSG00000015001
AA Change: G113D

DomainStartEndE-ValueType
internal_repeat_1 2 67 2.77e-7 PROSPERO
PA2c 159 274 3.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147776
SMART Domains Protein: ENSMUSP00000118937
Gene: ENSMUSG00000015001

DomainStartEndE-ValueType
PA2c 122 220 8.1e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156996
AA Change: G236D
SMART Domains Protein: ENSMUSP00000121227
Gene: ENSMUSG00000015001
AA Change: G236D

DomainStartEndE-ValueType
PA2c 58 174 1.75e-15 SMART
PA2c 283 398 3.5e-15 SMART
low complexity region 415 427 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced, enlarged, and loose otoliths, and thin cupula, saccule, utricle and tectorial membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Oc90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Oc90 APN 15 65889591 missense probably benign 0.00
IGL01746:Oc90 APN 15 65889401 splice site probably benign
IGL02101:Oc90 APN 15 65897789 missense probably damaging 1.00
IGL02175:Oc90 APN 15 65883825 missense possibly damaging 0.96
IGL02691:Oc90 APN 15 65882561 missense probably damaging 1.00
IGL02947:Oc90 APN 15 65888134 missense probably benign 0.16
R0010:Oc90 UTSW 15 65876548 missense probably damaging 1.00
R0325:Oc90 UTSW 15 65897665 critical splice donor site probably null
R1466:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1466:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1496:Oc90 UTSW 15 65876521 missense probably damaging 1.00
R1584:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1837:Oc90 UTSW 15 65889680 missense probably damaging 1.00
R3552:Oc90 UTSW 15 65878801 missense possibly damaging 0.81
R4018:Oc90 UTSW 15 65887608 missense probably benign 0.00
R4515:Oc90 UTSW 15 65892393 missense probably damaging 0.96
R4700:Oc90 UTSW 15 65881505 missense possibly damaging 0.91
R4828:Oc90 UTSW 15 65881559 missense probably damaging 1.00
R5135:Oc90 UTSW 15 65883830 missense probably benign 0.00
R5727:Oc90 UTSW 15 65881539 missense possibly damaging 0.61
R5837:Oc90 UTSW 15 65876446 missense probably benign 0.03
R6086:Oc90 UTSW 15 65889711 missense probably damaging 1.00
R6807:Oc90 UTSW 15 65889614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTATGGAGGGTGATACC -3'
(R):5'- GAAGCTTCCTTCATGTCTGCAAAC -3'

Sequencing Primer
(F):5'- TTCCATCAGCAGGATATGGTC -3'
(R):5'- ACACAATGTGAGGTGTACTCTCC -3'
Posted On2016-07-22