Incidental Mutation 'R5427:Iqcf3'
ID426967
Institutional Source Beutler Lab
Gene Symbol Iqcf3
Ensembl Gene ENSMUSG00000023577
Gene NameIQ motif containing F3
Synonyms1700012F17Rik
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5427 (G1)
Quality Score208
Status Validated
Chromosome9
Chromosomal Location106503225-106561631 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 106543860 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062917] [ENSMUST00000186668]
Predicted Effect probably null
Transcript: ENSMUST00000062917
SMART Domains Protein: ENSMUSP00000054276
Gene: ENSMUSG00000023577

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
internal_repeat_1 48 61 1.14e-11 PROSPERO
low complexity region 65 74 N/A INTRINSIC
internal_repeat_1 83 96 1.14e-11 PROSPERO
IQ 128 150 8.58e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000186668
SMART Domains Protein: ENSMUSP00000140327
Gene: ENSMUSG00000023577

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
internal_repeat_1 48 60 1.04e-10 PROSPERO
low complexity region 65 74 N/A INTRINSIC
internal_repeat_1 83 95 1.04e-10 PROSPERO
IQ 99 121 4.3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215525
Meta Mutation Damage Score 0.8612 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Iqcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02974:Iqcf3 APN 9 106553645 nonsense probably null
R4766:Iqcf3 UTSW 9 106560949 critical splice donor site probably null
R4820:Iqcf3 UTSW 9 106553589 unclassified probably benign
R5333:Iqcf3 UTSW 9 106553661 missense possibly damaging 0.46
R5417:Iqcf3 UTSW 9 106554214 missense probably damaging 0.99
R6404:Iqcf3 UTSW 9 106552884 missense probably benign 0.06
R7543:Iqcf3 UTSW 9 106554226 missense possibly damaging 0.53
Z1176:Iqcf3 UTSW 9 106560988 missense unknown
Predicted Primers PCR Primer
(F):5'- CGCCGTTTAAGTACCTGTCTG -3'
(R):5'- TGAGGACTTCATGAGGTCTTCAG -3'

Sequencing Primer
(F):5'- CTGTGGAGGATGCTTCTCCAC -3'
(R):5'- CATGAGGTCTTCAGGATCCAAAAGTC -3'
Posted On2016-09-01