Incidental Mutation 'R5427:Olfr1487'
ID426984
Institutional Source Beutler Lab
Gene Symbol Olfr1487
Ensembl Gene ENSMUSG00000094846
Gene Nameolfactory receptor 1487
SynonymsMOR202-18, GA_x6K02T2RE5P-3951719-3952666
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13617375-13623072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13619350 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 20 (S20C)
Ref Sequence ENSEMBL: ENSMUSP00000146516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076856] [ENSMUST00000208347] [ENSMUST00000209005] [ENSMUST00000216688] [ENSMUST00000217061]
Predicted Effect probably benign
Transcript: ENSMUST00000076856
AA Change: S63C

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076128
Gene: ENSMUSG00000094846
AA Change: S63C

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-55 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1e-6 PFAM
Pfam:7tm_1 40 289 9.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208347
AA Change: S20C

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000209005
AA Change: S20C

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000216688
AA Change: S20C

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000217061
AA Change: S63C

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Olfr1487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Olfr1487 APN 19 13619746 missense probably damaging 1.00
R0281:Olfr1487 UTSW 19 13619485 missense probably benign 0.00
R0847:Olfr1487 UTSW 19 13619551 missense probably benign 0.10
R1852:Olfr1487 UTSW 19 13619603 missense probably damaging 0.99
R2026:Olfr1487 UTSW 19 13619581 missense probably damaging 1.00
R2877:Olfr1487 UTSW 19 13619632 missense probably damaging 0.97
R3965:Olfr1487 UTSW 19 13619201 missense probably damaging 1.00
R4935:Olfr1487 UTSW 19 13619702 missense probably benign 0.11
R5148:Olfr1487 UTSW 19 13619510 nonsense probably null
R5210:Olfr1487 UTSW 19 13619399 missense probably damaging 1.00
R5940:Olfr1487 UTSW 19 13619153 unclassified probably null
R6110:Olfr1487 UTSW 19 13619885 missense probably benign 0.03
R6125:Olfr1487 UTSW 19 13619885 missense probably benign 0.03
R6294:Olfr1487 UTSW 19 13619366 missense probably benign 0.08
R7051:Olfr1487 UTSW 19 13619405 missense possibly damaging 0.94
R7052:Olfr1487 UTSW 19 13619626 missense probably benign 0.13
R7324:Olfr1487 UTSW 19 13619578 missense probably benign
R7655:Olfr1487 UTSW 19 13619833 missense probably damaging 0.99
R7656:Olfr1487 UTSW 19 13619833 missense probably damaging 0.99
R7807:Olfr1487 UTSW 19 13619921 missense probably damaging 0.99
R7876:Olfr1487 UTSW 19 13619264 missense probably damaging 1.00
R7959:Olfr1487 UTSW 19 13619264 missense probably damaging 1.00
Z1176:Olfr1487 UTSW 19 13619662 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCTGACACACGAATACGAG -3'
(R):5'- ACGGTCATAGGCCATTGAGG -3'

Sequencing Primer
(F):5'- ATCACTTGCTGATGTCCAAATAC -3'
(R):5'- TGAGGCCAGCATGAAACTTTC -3'
Posted On2016-09-01