Incidental Mutation 'R5401:Smad5'
ID430009
Institutional Source Beutler Lab
Gene Symbol Smad5
Ensembl Gene ENSMUSG00000021540
Gene NameSMAD family member 5
SynonymsSmad 5, Madh5, MusMLP
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location56703010-56742377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56727469 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 157 (F157L)
Ref Sequence ENSEMBL: ENSMUSP00000105502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069557] [ENSMUST00000109874] [ENSMUST00000109876]
Predicted Effect probably benign
Transcript: ENSMUST00000069557
AA Change: F157L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065798
Gene: ENSMUSG00000021540
AA Change: F157L

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109874
AA Change: F157L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105500
Gene: ENSMUSG00000021540
AA Change: F157L

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109876
AA Change: F157L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105502
Gene: ENSMUSG00000021540
AA Change: F157L

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138677
Meta Mutation Damage Score 0.0671 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the transforming growth factor beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. The encoded protein is activated by bone morphogenetic proteins type 1 receptor kinase, and may be involved in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit vascular, craniofacial, and neural tube defects, improper turning, edema, and a deficiency of primordial germ cells. Mutants die between embryonic days 10.5 and 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Smad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Smad5 APN 13 56723667 missense probably benign 0.11
IGL01407:Smad5 APN 13 56735817 missense probably benign 0.00
IGL02267:Smad5 APN 13 56735790 splice site probably benign
IGL03014:Smad5 UTSW 13 56735941 missense probably damaging 1.00
R1317:Smad5 UTSW 13 56736071 splice site probably benign
R2001:Smad5 UTSW 13 56737374 missense probably damaging 0.99
R5551:Smad5 UTSW 13 56735841 missense probably damaging 1.00
R5734:Smad5 UTSW 13 56723804 missense probably damaging 1.00
R5796:Smad5 UTSW 13 56723832 missense probably damaging 0.98
R5988:Smad5 UTSW 13 56735985 missense probably damaging 0.99
R7557:Smad5 UTSW 13 56727469 missense probably benign 0.00
R7769:Smad5 UTSW 13 56733042 missense possibly damaging 0.95
R8110:Smad5 UTSW 13 56723888 missense probably damaging 1.00
Z1088:Smad5 UTSW 13 56728628 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTCACACAGGCTGAATG -3'
(R):5'- TACCTGGGAGTTGAAATGGAC -3'

Sequencing Primer
(F):5'- CTTCACACAGGCTGAATGCTAAAGG -3'
(R):5'- ACTTCCAGGTCCAGAGCTTG -3'
Posted On2016-09-06