Incidental Mutation 'R7557:Smad5'
ID584852
Institutional Source Beutler Lab
Gene Symbol Smad5
Ensembl Gene ENSMUSG00000021540
Gene NameSMAD family member 5
SynonymsSmad 5, Madh5, MusMLP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7557 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location56703010-56742377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56727469 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 157 (F157L)
Ref Sequence ENSEMBL: ENSMUSP00000105502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069557] [ENSMUST00000109874] [ENSMUST00000109876]
Predicted Effect probably benign
Transcript: ENSMUST00000069557
AA Change: F157L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065798
Gene: ENSMUSG00000021540
AA Change: F157L

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109874
AA Change: F157L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105500
Gene: ENSMUSG00000021540
AA Change: F157L

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109876
AA Change: F157L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105502
Gene: ENSMUSG00000021540
AA Change: F157L

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138677
Meta Mutation Damage Score 0.0671 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the transforming growth factor beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. The encoded protein is activated by bone morphogenetic proteins type 1 receptor kinase, and may be involved in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit vascular, craniofacial, and neural tube defects, improper turning, edema, and a deficiency of primordial germ cells. Mutants die between embryonic days 10.5 and 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,283 Q1078* probably null Het
1190002N15Rik T C 9: 94,520,538 D357G probably damaging Het
Aatk T C 11: 120,009,430 K1310R possibly damaging Het
Acaa2 C T 18: 74,795,159 T153M possibly damaging Het
Add3 A G 19: 53,239,437 T518A probably damaging Het
AI314180 A G 4: 58,849,691 Y483H possibly damaging Het
Cacnb4 T C 2: 52,469,567 E143G probably damaging Het
Cd209a T A 8: 3,745,541 T177S probably benign Het
Chp1 T A 2: 119,560,757 Y32N probably damaging Het
Clcn3 T C 8: 60,937,368 T180A probably damaging Het
Dctn2 C A 10: 127,278,404 T373N probably benign Het
Emb T A 13: 117,249,716 N136K probably benign Het
Enpp2 A T 15: 54,910,140 C62S probably damaging Het
Fam198b A T 3: 79,886,608 K128* probably null Het
Fbxo28 G T 1: 182,341,435 A52E unknown Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Ggta1 T C 2: 35,402,536 D253G probably damaging Het
Gps1 C T 11: 120,786,367 A164V probably benign Het
Gramd4 C T 15: 86,100,900 Q146* probably null Het
Kcnh5 A T 12: 75,007,625 M515K possibly damaging Het
Klrc3 T C 6: 129,639,144 T203A probably damaging Het
Krt26 G T 11: 99,334,741 R305S probably damaging Het
Lpin1 A G 12: 16,580,792 V35A Het
Marf1 C T 16: 14,132,696 R942H probably damaging Het
Mfhas1 T A 8: 35,589,604 M411K possibly damaging Het
Mok A G 12: 110,808,399 S330P probably benign Het
Msto1 A G 3: 88,910,128 probably null Het
Olfr1490 T A 19: 13,655,026 I199N possibly damaging Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pcdhgb4 T A 18: 37,722,794 C747* probably null Het
Pih1d1 A G 7: 45,156,759 T40A probably benign Het
Pih1d2 A T 9: 50,624,916 E290D probably damaging Het
Plce1 A G 19: 38,765,404 K1849E probably benign Het
Plekha5 T C 6: 140,426,545 Y74H probably damaging Het
Pole T G 5: 110,312,994 I1183S probably damaging Het
Ptgs1 T C 2: 36,245,211 S396P possibly damaging Het
Rasa2 T C 9: 96,557,425 E575G probably damaging Het
Sec22b A G 3: 97,901,358 T5A probably damaging Het
Slc18a1 T A 8: 69,065,561 D267V probably damaging Het
Tcea1 T A 1: 4,894,990 C294* probably null Het
Txndc15 T A 13: 55,717,954 M77K probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r1 T A 3: 64,090,054 V377D probably damaging Het
Vmn2r7 A G 3: 64,724,973 Y23H probably benign Het
Vwa3a T A 7: 120,795,618 M887K possibly damaging Het
Zbtb5 T C 4: 44,995,196 N63D probably damaging Het
Zcchc6 T C 13: 59,788,466 I1274V possibly damaging Het
Other mutations in Smad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Smad5 APN 13 56723667 missense probably benign 0.11
IGL01407:Smad5 APN 13 56735817 missense probably benign 0.00
IGL02267:Smad5 APN 13 56735790 splice site probably benign
IGL03014:Smad5 UTSW 13 56735941 missense probably damaging 1.00
R1317:Smad5 UTSW 13 56736071 splice site probably benign
R2001:Smad5 UTSW 13 56737374 missense probably damaging 0.99
R5401:Smad5 UTSW 13 56727469 missense probably benign 0.00
R5551:Smad5 UTSW 13 56735841 missense probably damaging 1.00
R5734:Smad5 UTSW 13 56723804 missense probably damaging 1.00
R5796:Smad5 UTSW 13 56723832 missense probably damaging 0.98
R5988:Smad5 UTSW 13 56735985 missense probably damaging 0.99
R7769:Smad5 UTSW 13 56733042 missense possibly damaging 0.95
R8110:Smad5 UTSW 13 56723888 missense probably damaging 1.00
Z1088:Smad5 UTSW 13 56728628 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAACTTCCTGCTTCCAGAG -3'
(R):5'- ACTTCCAGGTCCAGAGCTTG -3'

Sequencing Primer
(F):5'- GAGTCCTTCACACAGGCTGAATG -3'
(R):5'- CAGAGCTTGCTGGGGAGTTG -3'
Posted On2019-10-17