Incidental Mutation 'R5401:Camkk2'
ID429983
Institutional Source Beutler Lab
Gene Symbol Camkk2
Ensembl Gene ENSMUSG00000029471
Gene Namecalcium/calmodulin-dependent protein kinase kinase 2, beta
Synonyms6330570N16Rik
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122731170-122779409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122746335 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 341 (D341V)
Ref Sequence ENSEMBL: ENSMUSP00000143732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111668] [ENSMUST00000197373] [ENSMUST00000198029] [ENSMUST00000200109]
Predicted Effect probably damaging
Transcript: ENSMUST00000111668
AA Change: D341V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107297
Gene: ENSMUSG00000029471
AA Change: D341V

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197373
SMART Domains Protein: ENSMUSP00000142717
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
SCOP:d1phk__ 1 41 3e-8 SMART
PDB:2ZV2|A 1 42 8e-20 PDB
Blast:S_TKc 1 48 4e-23 BLAST
low complexity region 91 109 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198029
AA Change: D136V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142896
Gene: ENSMUSG00000029471
AA Change: D136V

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
S_TKc 18 235 8.2e-12 SMART
low complexity region 259 267 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199988
Predicted Effect probably damaging
Transcript: ENSMUST00000200109
AA Change: D341V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143732
Gene: ENSMUSG00000029471
AA Change: D341V

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Meta Mutation Damage Score 0.8851 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the Serine/Threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. The major isoform of this gene plays a role in the calcium/calmodulin-dependent (CaM) kinase cascade by phosphorylating the downstream kinases CaMK1 and CaMK4. Protein products of this gene also phosphorylate AMP-activated protein kinase (AMPK). This gene has its strongest expression in the brain and influences signalling cascades involved with learning and memory, neuronal differentiation and migration, neurite outgrowth, and synapse formation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. The identified isoforms differ in their ability to undergo autophosphorylation and to phosphorylate downstream kinases. [provided by RefSeq, Jul 2012]
PHENOTYPE: Inactivation of this locus results in impaird long term potentiation and defects in some types of long term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Camkk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Camkk2 APN 5 122763950 missense probably damaging 1.00
IGL02321:Camkk2 APN 5 122764127 missense probably damaging 0.96
IGL02619:Camkk2 APN 5 122764235 missense probably damaging 0.98
IGL03356:Camkk2 APN 5 122743874 missense probably damaging 1.00
R0056:Camkk2 UTSW 5 122742198 missense probably damaging 1.00
R0078:Camkk2 UTSW 5 122757559 critical splice donor site probably null
R0344:Camkk2 UTSW 5 122763877 missense probably benign
R1480:Camkk2 UTSW 5 122734278 intron probably null
R1591:Camkk2 UTSW 5 122757558 critical splice donor site probably null
R1816:Camkk2 UTSW 5 122734180 missense probably damaging 1.00
R1960:Camkk2 UTSW 5 122737512 nonsense probably null
R1985:Camkk2 UTSW 5 122764127 missense possibly damaging 0.81
R2256:Camkk2 UTSW 5 122746335 missense probably damaging 1.00
R4297:Camkk2 UTSW 5 122745706 critical splice donor site probably null
R4687:Camkk2 UTSW 5 122753724 missense probably damaging 1.00
R5802:Camkk2 UTSW 5 122734244 missense probably damaging 0.99
R6167:Camkk2 UTSW 5 122764124 missense probably damaging 0.96
R6508:Camkk2 UTSW 5 122746319 missense probably damaging 0.96
R7313:Camkk2 UTSW 5 122737511 missense possibly damaging 0.55
R7504:Camkk2 UTSW 5 122746308 missense probably damaging 1.00
R7626:Camkk2 UTSW 5 122764300 splice site probably benign
R7664:Camkk2 UTSW 5 122756582 missense unknown
R7698:Camkk2 UTSW 5 122746419 missense probably damaging 0.96
R7805:Camkk2 UTSW 5 122742212 missense possibly damaging 0.92
R8289:Camkk2 UTSW 5 122756626 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCCGATCCTTGTGTGAG -3'
(R):5'- GGAGATTTTCACGGGGTCTC -3'

Sequencing Primer
(F):5'- AGTTCACGGGCGACATGAC -3'
(R):5'- GGTCTCCCTGCCCCGTC -3'
Posted On2016-09-06