Incidental Mutation 'R5505:Rsbn1'
ID430870
Institutional Source Beutler Lab
Gene Symbol Rsbn1
Ensembl Gene ENSMUSG00000044098
Gene Namerosbin, round spermatid basic protein 1
SynonymsC230004D03Rik, Rsbp
MMRRC Submission 043066-MU
Accession Numbers

Genbank: NM_172684; MGI: 2444993

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103914120-103966636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103928943 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 432 (N432K)
Ref Sequence ENSEMBL: ENSMUSP00000069246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051139] [ENSMUST00000068879]
Predicted Effect probably damaging
Transcript: ENSMUST00000051139
AA Change: N432K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058934
Gene: ENSMUSG00000044098
AA Change: N432K

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 466 477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068879
AA Change: N432K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069246
Gene: ENSMUSG00000044098
AA Change: N432K

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 131 156 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
low complexity region 252 261 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106806
AA Change: N385K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102418
Gene: ENSMUSG00000044098
AA Change: N385K

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 466 477 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151927
AA Change: N393K
SMART Domains Protein: ENSMUSP00000115693
Gene: ENSMUSG00000044098
AA Change: N393K

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000185731
AA Change: N108K
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
Allele List at MGI

All alleles(9) : Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cckar A G 5: 53,703,068 Y140H probably damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Gpr22 T C 12: 31,709,725 I133V probably damaging Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Ints8 T A 4: 11,221,143 Q744L probably benign Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mgat4a T C 1: 37,495,954 I108V probably benign Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Olfr1094 T C 2: 86,829,501 F250L possibly damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Sh3yl1 T A 12: 30,942,073 Y176N probably damaging Het
Slc25a30 G A 14: 75,763,349 L272F probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Srsf5 T C 12: 80,949,083 probably benign Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Tuba4a A G 1: 75,216,416 Y185H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Zfp941 C T 7: 140,811,917 V510I probably benign Het
Other mutations in Rsbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rsbn1 APN 3 103928690 missense probably benign 0.01
IGL00725:Rsbn1 APN 3 103928821 missense probably damaging 0.96
IGL01682:Rsbn1 APN 3 103962380 missense probably benign 0.03
IGL01978:Rsbn1 APN 3 103961500 missense probably damaging 0.99
IGL02281:Rsbn1 APN 3 103962461 missense probably damaging 0.99
IGL02615:Rsbn1 APN 3 103953752 missense probably damaging 1.00
IGL02902:Rsbn1 APN 3 103953656 missense possibly damaging 0.62
IGL02903:Rsbn1 APN 3 103928569 missense probably damaging 1.00
IGL02927:Rsbn1 APN 3 103962352 missense probably benign
IGL03007:Rsbn1 APN 3 103928879 missense probably damaging 1.00
IGL03062:Rsbn1 APN 3 103953629 intron probably benign
IGL03345:Rsbn1 APN 3 103915150 missense possibly damaging 0.78
F2404:Rsbn1 UTSW 3 103914576 nonsense probably null
R0277:Rsbn1 UTSW 3 103914581 missense possibly damaging 0.66
R0815:Rsbn1 UTSW 3 103954153 missense probably damaging 0.98
R1760:Rsbn1 UTSW 3 103960031 missense probably damaging 1.00
R1801:Rsbn1 UTSW 3 103914872 missense probably damaging 0.97
R2021:Rsbn1 UTSW 3 103914473 missense probably benign
R2078:Rsbn1 UTSW 3 103961523 missense probably damaging 1.00
R2330:Rsbn1 UTSW 3 103914500 missense probably damaging 0.97
R3956:Rsbn1 UTSW 3 103928675 missense probably damaging 0.99
R4094:Rsbn1 UTSW 3 103928658 missense probably damaging 0.98
R4649:Rsbn1 UTSW 3 103953780 splice site probably null
R4720:Rsbn1 UTSW 3 103929020 missense possibly damaging 0.92
R5299:Rsbn1 UTSW 3 103914490 missense probably benign 0.01
R5699:Rsbn1 UTSW 3 103962485 missense probably benign 0.02
R5775:Rsbn1 UTSW 3 103962572 missense possibly damaging 0.80
R6509:Rsbn1 UTSW 3 103960032 missense probably damaging 1.00
R6629:Rsbn1 UTSW 3 103928441 missense probably damaging 1.00
R7070:Rsbn1 UTSW 3 103928983 missense probably damaging 1.00
R7116:Rsbn1 UTSW 3 103914576 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCATACATGGACGAACTCTC -3'
(R):5'- TCGCTAATGTTACCCTAAGGC -3'

Sequencing Primer
(F):5'- ACATGGACGAACTCTCATTTTTGTC -3'
(R):5'- TGTTACCCTAAGGCTACAATGTC -3'
Posted On2016-10-05