Incidental Mutation 'R0469:Stk11'
ID43152
Institutional Source Beutler Lab
Gene Symbol Stk11
Ensembl Gene ENSMUSG00000003068
Gene Nameserine/threonine kinase 11
SynonymsPar-4, Lkb1
MMRRC Submission 038669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0469 (G1)
Quality Score224
Status Not validated
Chromosome10
Chromosomal Location80115803-80130682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80126086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 47 (V47A)
Ref Sequence ENSEMBL: ENSMUSP00000101009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003152] [ENSMUST00000105369] [ENSMUST00000105370] [ENSMUST00000105371] [ENSMUST00000144883] [ENSMUST00000147778] [ENSMUST00000152592] [ENSMUST00000169546] [ENSMUST00000170219] [ENSMUST00000213772]
Predicted Effect probably damaging
Transcript: ENSMUST00000003152
AA Change: V173A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003152
Gene: ENSMUSG00000003068
AA Change: V173A

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105369
SMART Domains Protein: ENSMUSP00000101008
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105370
AA Change: V47A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101009
Gene: ENSMUSG00000003068
AA Change: V47A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 180 2.8e-22 PFAM
Pfam:Pkinase 1 183 2.8e-40 PFAM
Pfam:Kinase-like 8 171 5.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144119
Predicted Effect probably damaging
Transcript: ENSMUST00000144883
AA Change: V173A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114195
Gene: ENSMUSG00000003068
AA Change: V173A

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
low complexity region 396 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147778
SMART Domains Protein: ENSMUSP00000130389
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152592
SMART Domains Protein: ENSMUSP00000118853
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
Blast:S_TKc 1 53 6e-31 BLAST
PDB:2WTK|F 1 74 1e-40 PDB
SCOP:d1koba_ 1 89 1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169546
SMART Domains Protein: ENSMUSP00000132978
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 192 204 N/A INTRINSIC
low complexity region 276 284 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 451 491 N/A INTRINSIC
low complexity region 522 541 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
low complexity region 634 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170219
SMART Domains Protein: ENSMUSP00000131487
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213772
AA Change: V173A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the serine/threonine kinase family. The encoded protein, a known tumor suppressor, activates (via phosphorylation) adenine monophosphate-activated protein kinase (AMPK) and AMPK-related kinase proteins. This upstream regulation of the AMPK pathway is thought to regulate a number of different processes, including cell metabolism, cell polarity, apoptosis and DNA damage response. Mutations in a similar gene in human have been associated with Peutz-Jeghers syndrome. Alternative splicing results in multiple transcript variants, including the S isoform which plays a potential role in spermiogenesis. [provided by RefSeq, Sep 2014]
PHENOTYPE: Targeted heterozygous mutants with one inactivated allele develop benign gastrointestinal polyps. Homozygous null mutant are embryonic lethal. Homozygotes for a hypomorphic allele survive and apparently normal, but male mice are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Arpc1b T A 5: 145,127,715 W361R probably damaging Het
B3gntl1 A T 11: 121,673,025 V3D probably benign Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dnah12 A G 14: 26,798,899 R1892G probably damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Golgb1 A G 16: 36,931,635 I3144V probably benign Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr338 A T 2: 36,377,462 I229F probably benign Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rbmx C T X: 57,391,566 probably null Het
Rbp3 A G 14: 33,962,419 K1135R possibly damaging Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tm9sf1 A T 14: 55,641,429 F169I possibly damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpr AAGAGAGAGAGAGAG AAGAGAGAGAGAG 1: 150,423,667 probably null Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Upb1 T C 10: 75,415,083 probably null Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Wdr73 G A 7: 80,897,950 Q107* probably null Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Stk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02695:Stk11 APN 10 80125477 critical splice acceptor site probably null
IGL03055:Stk11 UTSW 10 80128086 missense probably damaging 1.00
R0450:Stk11 UTSW 10 80126086 missense probably damaging 1.00
R0501:Stk11 UTSW 10 80126285 missense probably damaging 1.00
R3826:Stk11 UTSW 10 80127948 unclassified probably null
R3827:Stk11 UTSW 10 80127948 unclassified probably null
R3828:Stk11 UTSW 10 80127948 unclassified probably null
R3829:Stk11 UTSW 10 80127948 unclassified probably null
R4512:Stk11 UTSW 10 80126377 splice site probably benign
R4515:Stk11 UTSW 10 80116601 unclassified probably benign
R5123:Stk11 UTSW 10 80127941 missense probably damaging 1.00
R5188:Stk11 UTSW 10 80126279 missense probably damaging 1.00
R5341:Stk11 UTSW 10 80126260 missense probably benign 0.13
R5540:Stk11 UTSW 10 80126049 missense probably benign 0.00
R6856:Stk11 UTSW 10 80128090 missense probably benign 0.01
R7213:Stk11 UTSW 10 80116618 start codon destroyed probably null 0.05
Predicted Primers PCR Primer
(F):5'- TCTATCACCTTGTAGGCCAGGTCTC -3'
(R):5'- GGTGTCCAGTCCATTGGCAATCTC -3'

Sequencing Primer
(F):5'- CATGAGTCTCCCAAACTTCATATCAG -3'
(R):5'- TCCATTGGCAATCTCAGGAG -3'
Posted On2013-05-23