Incidental Mutation 'R0478:St3gal1'
ID43215
Institutional Source Beutler Lab
Gene Symbol St3gal1
Ensembl Gene ENSMUSG00000013846
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 1
SynonymsSiat4a, CMP-N-acetylneuraminate: [beta-galactosidase alpha-2,3] sialytransferase, ST3GalI, Siat4
MMRRC Submission 038678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0478 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location67102875-67176830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67113730 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 25 (Y25C)
Ref Sequence ENSEMBL: ENSMUSP00000155359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092640] [ENSMUST00000229028] [ENSMUST00000229213]
Predicted Effect probably damaging
Transcript: ENSMUST00000092640
AA Change: Y25C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090307
Gene: ENSMUSG00000013846
AA Change: Y25C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 80 336 1.7e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229028
AA Change: Y25C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000229213
AA Change: Y25C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230150
Meta Mutation Damage Score 0.4519 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. Correct glycosylation of the encoded protein may be critical to its sialyltransferase activity. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4B. Two transcript variants encoding the same protein have been found for this gene. Other transcript variants may exist, but have not been fully characterized yet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,562,589 noncoding transcript Het
4930556J24Rik T G 11: 3,976,259 probably benign Het
Acnat1 T G 4: 49,450,901 D70A probably damaging Het
Adnp2 A G 18: 80,129,334 V620A probably benign Het
Aldoart1 T A 4: 72,852,343 H21L probably benign Het
Birc3 A G 9: 7,860,347 V290A probably damaging Het
Bpifb3 C T 2: 153,931,480 probably benign Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Clmn A G 12: 104,785,491 M235T probably damaging Het
Dmbt1 A G 7: 131,041,187 E245G possibly damaging Het
Epgn G T 5: 91,031,128 V36L probably benign Het
Ets2 C A 16: 95,716,262 P346Q probably damaging Het
Fam222b T C 11: 78,153,856 L81P probably damaging Het
Fancf A C 7: 51,861,692 L188R probably damaging Het
Fibin T C 2: 110,362,734 D21G possibly damaging Het
Fzd6 A G 15: 39,034,034 probably null Het
Gbp4 T A 5: 105,119,433 Q540L probably benign Het
Greb1l T A 18: 10,509,281 L531Q probably damaging Het
Il5ra A G 6: 106,738,462 V137A probably benign Het
Kif26a G A 12: 112,175,789 A826T probably damaging Het
Kiz T C 2: 146,942,158 V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 G15D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lbp T C 2: 158,317,528 probably benign Het
Mmp25 T C 17: 23,632,782 T318A probably benign Het
Mrpl50 A G 4: 49,514,513 C53R probably damaging Het
Msl3l2 G C 10: 56,115,315 E45D probably damaging Het
Nfxl1 A G 5: 72,524,645 probably null Het
Noc3l A G 19: 38,810,006 probably null Het
Olfr1126 T A 2: 87,458,026 V287E probably damaging Het
Olfr1375 T C 11: 51,048,712 S202P probably benign Het
Pgm5 A T 19: 24,834,869 S100T possibly damaging Het
Pi4ka C T 16: 17,309,311 G1093S possibly damaging Het
Pitrm1 T A 13: 6,559,395 S350T probably damaging Het
Ptk2b G T 14: 66,213,372 N48K probably damaging Het
Sept3 T C 15: 82,290,806 L172P probably damaging Het
Sirt3 A T 7: 140,878,114 C41S probably benign Het
Sphkap C T 1: 83,278,711 R152H probably damaging Het
Tbc1d31 T C 15: 57,932,536 F175S probably damaging Het
Tfdp2 T A 9: 96,290,583 D43E probably benign Het
Tgm1 G A 14: 55,700,334 Q773* probably null Het
Tmc3 A T 7: 83,622,152 R837S possibly damaging Het
Unc13a A G 8: 71,651,148 V880A possibly damaging Het
Vmn1r237 T A 17: 21,314,819 V268E probably damaging Het
Zan C T 5: 137,400,526 probably benign Het
Zfp760 G T 17: 21,722,014 E57* probably null Het
Other mutations in St3gal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:St3gal1 APN 15 67112617 missense probably benign 0.03
Benelux UTSW 15 67113785 nonsense probably null
Luxembourg UTSW 15 67111346 missense possibly damaging 0.52
Strasbourg UTSW 15 67106673 missense probably damaging 0.99
R0452:St3gal1 UTSW 15 67109655 splice site probably benign
R0735:St3gal1 UTSW 15 67113687 missense probably benign
R2357:St3gal1 UTSW 15 67113782 missense probably benign 0.01
R5061:St3gal1 UTSW 15 67108229 missense probably benign 0.40
R5199:St3gal1 UTSW 15 67113715 missense probably benign 0.00
R5734:St3gal1 UTSW 15 67106673 missense probably damaging 0.99
R5828:St3gal1 UTSW 15 67113785 nonsense probably null
R6370:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6371:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6373:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6385:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6387:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6388:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6417:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6420:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6421:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6462:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6463:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6469:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6473:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6474:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6759:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6760:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6894:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6963:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7250:St3gal1 UTSW 15 67106729 missense possibly damaging 0.89
R7394:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7588:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7590:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7591:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7860:St3gal1 UTSW 15 67111265 missense probably benign 0.38
R7943:St3gal1 UTSW 15 67111265 missense probably benign 0.38
Z1177:St3gal1 UTSW 15 67111367 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCGCTGGTCGAACCAATATGATACC -3'
(R):5'- TGTGCCACACAGCAATGTCGAG -3'

Sequencing Primer
(F):5'- GTCGAACCAATATGATACCTTGTCC -3'
(R):5'- TCCAACAGGCTGAAGTTTGC -3'
Posted On2013-05-23