Incidental Mutation 'R5496:Uspl1'
ID 432342
Institutional Source Beutler Lab
Gene Symbol Uspl1
Ensembl Gene ENSMUSG00000041264
Gene Name ubiquitin specific peptidase like 1
Synonyms E430026A01Rik
MMRRC Submission 043057-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R5496 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 149121338-149152246 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 149146589 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 447 (T447A)
Ref Sequence ENSEMBL: ENSMUSP00000113247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050472] [ENSMUST00000100410] [ENSMUST00000117878] [ENSMUST00000119685] [ENSMUST00000121416] [ENSMUST00000122160] [ENSMUST00000126168]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000050472
AA Change: T447A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050172
Gene: ENSMUSG00000041264
AA Change: T447A

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 7e-139 PFAM
Pfam:DUF4650 557 1087 1.9e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100410
AA Change: T447A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097978
Gene: ENSMUSG00000041264
AA Change: T447A

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 1.4e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117878
AA Change: T248A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113176
Gene: ENSMUSG00000041264
AA Change: T248A

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 5.6e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119685
AA Change: T433A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114104
Gene: ENSMUSG00000041264
AA Change: T433A

DomainStartEndE-ValueType
low complexity region 160 178 N/A INTRINSIC
Pfam:Peptidase_C98 199 472 6.9e-139 PFAM
Pfam:DUF4650 543 1073 1.8e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121416
AA Change: T248A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113894
Gene: ENSMUSG00000041264
AA Change: T248A

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 8.5e-139 PFAM
Pfam:DUF4650 358 888 1.5e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122160
AA Change: T447A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113247
Gene: ENSMUSG00000041264
AA Change: T447A

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 214 486 2.5e-125 PFAM
Pfam:DUF4650 558 1087 1e-205 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150921
Predicted Effect probably benign
Transcript: ENSMUST00000126168
Meta Mutation Damage Score 0.3198 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,724,818 (GRCm39) V84I probably benign Het
Adam10 T G 9: 70,630,021 (GRCm39) F151C probably damaging Het
Akap6 A G 12: 53,187,436 (GRCm39) S1617G possibly damaging Het
Ano6 T A 15: 95,865,495 (GRCm39) probably null Het
Atmin A G 8: 117,683,911 (GRCm39) T524A probably benign Het
Bicra C T 7: 15,721,766 (GRCm39) V584I probably benign Het
Carmil1 G A 13: 24,339,433 (GRCm39) R54C probably damaging Het
Cbln1 A G 8: 88,198,324 (GRCm39) I127T possibly damaging Het
Ccl26 A G 5: 135,592,217 (GRCm39) V40A probably benign Het
Cdh20 T A 1: 109,976,647 (GRCm39) I104N probably damaging Het
Cdt1 C T 8: 123,297,239 (GRCm39) R311W probably damaging Het
Cfap91 A G 16: 38,141,855 (GRCm39) I359T probably damaging Het
Col12a1 A G 9: 79,509,467 (GRCm39) probably benign Het
Csf2rb A G 15: 78,224,761 (GRCm39) E173G probably damaging Het
Cyb561 A G 11: 105,828,545 (GRCm39) Y94H probably damaging Het
Cyp3a16 T A 5: 145,404,341 (GRCm39) K34M probably damaging Het
Diras2 C T 13: 52,661,786 (GRCm39) V174M probably benign Het
Dnah7a T G 1: 53,496,927 (GRCm39) M3110L probably benign Het
Dyrk2 T C 10: 118,695,956 (GRCm39) E434G probably damaging Het
Ebag9 T G 15: 44,503,816 (GRCm39) *214E probably null Het
Egln3 A T 12: 54,250,110 (GRCm39) W80R probably damaging Het
Eps15l1 A G 8: 73,136,619 (GRCm39) Y336H probably benign Het
Gak A G 5: 108,724,483 (GRCm39) S1076P probably benign Het
Glra1 T C 11: 55,418,241 (GRCm39) Y168C probably damaging Het
Glrx2 T A 1: 143,620,945 (GRCm39) M108K probably damaging Het
Gm3604 A T 13: 62,519,393 (GRCm39) S59T possibly damaging Het
Gm8212 A T 14: 44,438,614 (GRCm39) probably benign Het
Gmcl1 G T 6: 86,674,507 (GRCm39) A457D probably damaging Het
H2-M11 T C 17: 36,858,871 (GRCm39) F137S possibly damaging Het
Ighv1-55 C G 12: 115,172,140 (GRCm39) W3S probably damaging Het
Il22 T G 10: 118,041,002 (GRCm39) V36G possibly damaging Het
Ints1 G A 5: 139,740,953 (GRCm39) A1904V probably benign Het
Iqgap2 A G 13: 95,766,561 (GRCm39) Y1481H probably damaging Het
Kcnn3 C T 3: 89,516,797 (GRCm39) A402V possibly damaging Het
Kif18b A T 11: 102,804,568 (GRCm39) I362N possibly damaging Het
Kif5c C G 2: 49,620,202 (GRCm39) A223G possibly damaging Het
Kntc1 A G 5: 123,922,245 (GRCm39) D948G probably benign Het
Krba1 A G 6: 48,383,290 (GRCm39) T229A possibly damaging Het
Leprot T A 4: 101,515,093 (GRCm39) I113N probably damaging Het
Lrp1b T C 2: 40,817,985 (GRCm39) D2415G probably benign Het
Mnd1 T A 3: 83,995,481 (GRCm39) D171V probably damaging Het
Mthfsd A T 8: 121,825,553 (GRCm39) Y339* probably null Het
Nfatc2 G A 2: 168,378,198 (GRCm39) T268M probably damaging Het
Or14j10 T C 17: 37,935,469 (GRCm39) D19G probably benign Het
Or52d3 G C 7: 104,229,701 (GRCm39) A283P probably damaging Het
Or8h7 G T 2: 86,720,658 (GRCm39) P287Q probably damaging Het
Or8h7 G C 2: 86,720,659 (GRCm39) P287A probably damaging Het
Pan3 G A 5: 147,463,938 (GRCm39) probably null Het
Pde6a A T 18: 61,386,736 (GRCm39) probably null Het
Prss39 T C 1: 34,539,342 (GRCm39) I194T possibly damaging Het
Rfx8 T C 1: 39,709,507 (GRCm39) S507G probably benign Het
Rif1 T C 2: 51,988,928 (GRCm39) S774P probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Smurf1 C A 5: 144,819,403 (GRCm39) E601* probably null Het
Stau2 T C 1: 16,460,245 (GRCm39) S231G probably damaging Het
Timp2 T G 11: 118,194,707 (GRCm39) M161L probably benign Het
Tlr5 T C 1: 182,801,197 (GRCm39) L167P probably damaging Het
Trhr G A 15: 44,060,932 (GRCm39) A151T probably benign Het
Unc13d A G 11: 115,957,534 (GRCm39) V807A probably damaging Het
Usp2 T C 9: 43,996,505 (GRCm39) V7A possibly damaging Het
Zan A G 5: 137,434,607 (GRCm39) I2232T unknown Het
Zfp12 C A 5: 143,230,550 (GRCm39) C292* probably null Het
Zfp850 A C 7: 27,706,771 (GRCm39) M43R probably damaging Het
Zic5 G A 14: 122,696,755 (GRCm39) T620M unknown Het
Other mutations in Uspl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Uspl1 APN 5 149,152,024 (GRCm39) missense possibly damaging 0.95
IGL00571:Uspl1 APN 5 149,125,170 (GRCm39) missense probably damaging 0.99
IGL01134:Uspl1 APN 5 149,141,103 (GRCm39) missense probably damaging 1.00
IGL02222:Uspl1 APN 5 149,130,854 (GRCm39) missense probably benign 0.25
IGL02383:Uspl1 APN 5 149,150,212 (GRCm39) missense probably damaging 0.98
IGL02538:Uspl1 APN 5 149,125,269 (GRCm39) missense probably damaging 1.00
IGL02546:Uspl1 APN 5 149,141,114 (GRCm39) missense possibly damaging 0.95
IGL02585:Uspl1 APN 5 149,150,872 (GRCm39) nonsense probably null
IGL02971:Uspl1 APN 5 149,125,156 (GRCm39) missense possibly damaging 0.84
R0020:Uspl1 UTSW 5 149,146,589 (GRCm39) missense probably damaging 1.00
R0070:Uspl1 UTSW 5 149,146,515 (GRCm39) missense probably damaging 1.00
R0142:Uspl1 UTSW 5 149,125,159 (GRCm39) missense possibly damaging 0.68
R0433:Uspl1 UTSW 5 149,151,625 (GRCm39) missense probably damaging 1.00
R0554:Uspl1 UTSW 5 149,124,644 (GRCm39) missense probably damaging 1.00
R0612:Uspl1 UTSW 5 149,151,767 (GRCm39) missense probably damaging 1.00
R1195:Uspl1 UTSW 5 149,131,131 (GRCm39) missense probably benign 0.24
R1195:Uspl1 UTSW 5 149,131,131 (GRCm39) missense probably benign 0.24
R1195:Uspl1 UTSW 5 149,131,131 (GRCm39) missense probably benign 0.24
R1465:Uspl1 UTSW 5 149,150,842 (GRCm39) missense probably benign 0.12
R1465:Uspl1 UTSW 5 149,150,842 (GRCm39) missense probably benign 0.12
R1623:Uspl1 UTSW 5 149,152,009 (GRCm39) missense probably damaging 1.00
R1737:Uspl1 UTSW 5 149,138,668 (GRCm39) missense probably damaging 1.00
R1793:Uspl1 UTSW 5 149,150,246 (GRCm39) missense probably damaging 1.00
R1823:Uspl1 UTSW 5 149,151,224 (GRCm39) missense probably benign 0.25
R2088:Uspl1 UTSW 5 149,146,560 (GRCm39) missense probably damaging 1.00
R2099:Uspl1 UTSW 5 149,151,568 (GRCm39) missense probably damaging 1.00
R2497:Uspl1 UTSW 5 149,124,664 (GRCm39) missense probably damaging 0.98
R2944:Uspl1 UTSW 5 149,138,606 (GRCm39) missense probably damaging 1.00
R3437:Uspl1 UTSW 5 149,151,507 (GRCm39) utr 3 prime probably benign
R4132:Uspl1 UTSW 5 149,141,159 (GRCm39) missense probably damaging 0.99
R4458:Uspl1 UTSW 5 149,150,962 (GRCm39) missense possibly damaging 0.82
R4537:Uspl1 UTSW 5 149,124,588 (GRCm39) missense possibly damaging 0.66
R4623:Uspl1 UTSW 5 149,151,405 (GRCm39) missense probably damaging 0.99
R4633:Uspl1 UTSW 5 149,151,202 (GRCm39) missense probably damaging 1.00
R4737:Uspl1 UTSW 5 149,131,149 (GRCm39) missense possibly damaging 0.86
R4743:Uspl1 UTSW 5 149,146,566 (GRCm39) missense probably damaging 1.00
R5200:Uspl1 UTSW 5 149,150,923 (GRCm39) missense probably benign 0.02
R5222:Uspl1 UTSW 5 149,150,911 (GRCm39) missense possibly damaging 0.77
R5337:Uspl1 UTSW 5 149,151,556 (GRCm39) missense probably damaging 0.99
R5654:Uspl1 UTSW 5 149,146,521 (GRCm39) missense probably damaging 1.00
R5845:Uspl1 UTSW 5 149,130,770 (GRCm39) missense probably benign 0.01
R6266:Uspl1 UTSW 5 149,141,176 (GRCm39) missense probably damaging 1.00
R6331:Uspl1 UTSW 5 149,151,097 (GRCm39) missense probably benign 0.40
R6338:Uspl1 UTSW 5 149,151,844 (GRCm39) missense probably benign 0.03
R6774:Uspl1 UTSW 5 149,150,904 (GRCm39) missense probably benign 0.00
R6855:Uspl1 UTSW 5 149,124,655 (GRCm39) missense probably damaging 1.00
R7131:Uspl1 UTSW 5 149,130,745 (GRCm39) missense probably benign 0.00
R7152:Uspl1 UTSW 5 149,124,588 (GRCm39) missense possibly damaging 0.66
R7446:Uspl1 UTSW 5 149,141,082 (GRCm39) nonsense probably null
R7661:Uspl1 UTSW 5 149,151,827 (GRCm39) missense probably benign 0.15
R8095:Uspl1 UTSW 5 149,150,992 (GRCm39) nonsense probably null
R8126:Uspl1 UTSW 5 149,151,430 (GRCm39) missense probably damaging 1.00
R8316:Uspl1 UTSW 5 149,135,491 (GRCm39) missense possibly damaging 0.75
R8479:Uspl1 UTSW 5 149,152,004 (GRCm39) missense probably damaging 1.00
R8926:Uspl1 UTSW 5 149,138,701 (GRCm39) critical splice donor site probably null
R9140:Uspl1 UTSW 5 149,150,290 (GRCm39) missense possibly damaging 0.57
R9178:Uspl1 UTSW 5 149,141,148 (GRCm39) missense probably damaging 1.00
R9196:Uspl1 UTSW 5 149,151,349 (GRCm39) missense probably benign 0.02
R9359:Uspl1 UTSW 5 149,146,481 (GRCm39) missense probably damaging 1.00
R9384:Uspl1 UTSW 5 149,151,349 (GRCm39) missense probably benign 0.02
R9608:Uspl1 UTSW 5 149,151,870 (GRCm39) missense probably benign 0.17
X0019:Uspl1 UTSW 5 149,151,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGTGGCATGAAATTGATTTG -3'
(R):5'- ATCGCAGTCAGGAAGGACAC -3'

Sequencing Primer
(F):5'- GAAATTGATTTGACTTGTGCCTCC -3'
(R):5'- CACCACGGTTAAGAAAGAGGAAC -3'
Posted On 2016-10-05