Incidental Mutation 'R4737:Uspl1'
ID 359331
Institutional Source Beutler Lab
Gene Symbol Uspl1
Ensembl Gene ENSMUSG00000041264
Gene Name ubiquitin specific peptidase like 1
Synonyms E430026A01Rik
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 149121338-149152246 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 149131149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 244 (L244Q)
Ref Sequence ENSEMBL: ENSMUSP00000113247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050472] [ENSMUST00000100410] [ENSMUST00000117878] [ENSMUST00000119685] [ENSMUST00000121416] [ENSMUST00000122160] [ENSMUST00000126168] [ENSMUST00000139474]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000050472
AA Change: L244Q

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050172
Gene: ENSMUSG00000041264
AA Change: L244Q

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 7e-139 PFAM
Pfam:DUF4650 557 1087 1.9e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100410
AA Change: L244Q

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097978
Gene: ENSMUSG00000041264
AA Change: L244Q

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 1.4e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117878
AA Change: L45Q

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113176
Gene: ENSMUSG00000041264
AA Change: L45Q

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 5.6e-140 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119685
AA Change: L230Q

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114104
Gene: ENSMUSG00000041264
AA Change: L230Q

DomainStartEndE-ValueType
low complexity region 160 178 N/A INTRINSIC
Pfam:Peptidase_C98 199 472 6.9e-139 PFAM
Pfam:DUF4650 543 1073 1.8e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121416
AA Change: L45Q

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113894
Gene: ENSMUSG00000041264
AA Change: L45Q

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 8.5e-139 PFAM
Pfam:DUF4650 358 888 1.5e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122160
AA Change: L244Q

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113247
Gene: ENSMUSG00000041264
AA Change: L244Q

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 214 486 2.5e-125 PFAM
Pfam:DUF4650 558 1087 1e-205 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149896
Predicted Effect probably benign
Transcript: ENSMUST00000126168
Predicted Effect probably benign
Transcript: ENSMUST00000139474
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Uspl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Uspl1 APN 5 149,152,024 (GRCm39) missense possibly damaging 0.95
IGL00571:Uspl1 APN 5 149,125,170 (GRCm39) missense probably damaging 0.99
IGL01134:Uspl1 APN 5 149,141,103 (GRCm39) missense probably damaging 1.00
IGL02222:Uspl1 APN 5 149,130,854 (GRCm39) missense probably benign 0.25
IGL02383:Uspl1 APN 5 149,150,212 (GRCm39) missense probably damaging 0.98
IGL02538:Uspl1 APN 5 149,125,269 (GRCm39) missense probably damaging 1.00
IGL02546:Uspl1 APN 5 149,141,114 (GRCm39) missense possibly damaging 0.95
IGL02585:Uspl1 APN 5 149,150,872 (GRCm39) nonsense probably null
IGL02971:Uspl1 APN 5 149,125,156 (GRCm39) missense possibly damaging 0.84
R0020:Uspl1 UTSW 5 149,146,589 (GRCm39) missense probably damaging 1.00
R0070:Uspl1 UTSW 5 149,146,515 (GRCm39) missense probably damaging 1.00
R0142:Uspl1 UTSW 5 149,125,159 (GRCm39) missense possibly damaging 0.68
R0433:Uspl1 UTSW 5 149,151,625 (GRCm39) missense probably damaging 1.00
R0554:Uspl1 UTSW 5 149,124,644 (GRCm39) missense probably damaging 1.00
R0612:Uspl1 UTSW 5 149,151,767 (GRCm39) missense probably damaging 1.00
R1195:Uspl1 UTSW 5 149,131,131 (GRCm39) missense probably benign 0.24
R1195:Uspl1 UTSW 5 149,131,131 (GRCm39) missense probably benign 0.24
R1195:Uspl1 UTSW 5 149,131,131 (GRCm39) missense probably benign 0.24
R1465:Uspl1 UTSW 5 149,150,842 (GRCm39) missense probably benign 0.12
R1465:Uspl1 UTSW 5 149,150,842 (GRCm39) missense probably benign 0.12
R1623:Uspl1 UTSW 5 149,152,009 (GRCm39) missense probably damaging 1.00
R1737:Uspl1 UTSW 5 149,138,668 (GRCm39) missense probably damaging 1.00
R1793:Uspl1 UTSW 5 149,150,246 (GRCm39) missense probably damaging 1.00
R1823:Uspl1 UTSW 5 149,151,224 (GRCm39) missense probably benign 0.25
R2088:Uspl1 UTSW 5 149,146,560 (GRCm39) missense probably damaging 1.00
R2099:Uspl1 UTSW 5 149,151,568 (GRCm39) missense probably damaging 1.00
R2497:Uspl1 UTSW 5 149,124,664 (GRCm39) missense probably damaging 0.98
R2944:Uspl1 UTSW 5 149,138,606 (GRCm39) missense probably damaging 1.00
R3437:Uspl1 UTSW 5 149,151,507 (GRCm39) utr 3 prime probably benign
R4132:Uspl1 UTSW 5 149,141,159 (GRCm39) missense probably damaging 0.99
R4458:Uspl1 UTSW 5 149,150,962 (GRCm39) missense possibly damaging 0.82
R4537:Uspl1 UTSW 5 149,124,588 (GRCm39) missense possibly damaging 0.66
R4623:Uspl1 UTSW 5 149,151,405 (GRCm39) missense probably damaging 0.99
R4633:Uspl1 UTSW 5 149,151,202 (GRCm39) missense probably damaging 1.00
R4743:Uspl1 UTSW 5 149,146,566 (GRCm39) missense probably damaging 1.00
R5200:Uspl1 UTSW 5 149,150,923 (GRCm39) missense probably benign 0.02
R5222:Uspl1 UTSW 5 149,150,911 (GRCm39) missense possibly damaging 0.77
R5337:Uspl1 UTSW 5 149,151,556 (GRCm39) missense probably damaging 0.99
R5496:Uspl1 UTSW 5 149,146,589 (GRCm39) missense probably damaging 1.00
R5654:Uspl1 UTSW 5 149,146,521 (GRCm39) missense probably damaging 1.00
R5845:Uspl1 UTSW 5 149,130,770 (GRCm39) missense probably benign 0.01
R6266:Uspl1 UTSW 5 149,141,176 (GRCm39) missense probably damaging 1.00
R6331:Uspl1 UTSW 5 149,151,097 (GRCm39) missense probably benign 0.40
R6338:Uspl1 UTSW 5 149,151,844 (GRCm39) missense probably benign 0.03
R6774:Uspl1 UTSW 5 149,150,904 (GRCm39) missense probably benign 0.00
R6855:Uspl1 UTSW 5 149,124,655 (GRCm39) missense probably damaging 1.00
R7131:Uspl1 UTSW 5 149,130,745 (GRCm39) missense probably benign 0.00
R7152:Uspl1 UTSW 5 149,124,588 (GRCm39) missense possibly damaging 0.66
R7446:Uspl1 UTSW 5 149,141,082 (GRCm39) nonsense probably null
R7661:Uspl1 UTSW 5 149,151,827 (GRCm39) missense probably benign 0.15
R8095:Uspl1 UTSW 5 149,150,992 (GRCm39) nonsense probably null
R8126:Uspl1 UTSW 5 149,151,430 (GRCm39) missense probably damaging 1.00
R8316:Uspl1 UTSW 5 149,135,491 (GRCm39) missense possibly damaging 0.75
R8479:Uspl1 UTSW 5 149,152,004 (GRCm39) missense probably damaging 1.00
R8926:Uspl1 UTSW 5 149,138,701 (GRCm39) critical splice donor site probably null
R9140:Uspl1 UTSW 5 149,150,290 (GRCm39) missense possibly damaging 0.57
R9178:Uspl1 UTSW 5 149,141,148 (GRCm39) missense probably damaging 1.00
R9196:Uspl1 UTSW 5 149,151,349 (GRCm39) missense probably benign 0.02
R9359:Uspl1 UTSW 5 149,146,481 (GRCm39) missense probably damaging 1.00
R9384:Uspl1 UTSW 5 149,151,349 (GRCm39) missense probably benign 0.02
R9608:Uspl1 UTSW 5 149,151,870 (GRCm39) missense probably benign 0.17
X0019:Uspl1 UTSW 5 149,151,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCTACAGAAGATCCTGCTAC -3'
(R):5'- TCATGAGCTGTAACTGGCAC -3'

Sequencing Primer
(F):5'- GCTACAGTTAGTGTCACATCTGAGC -3'
(R):5'- GAGCTGTAACTGGCACTATCTCTAG -3'
Posted On 2015-11-11