Mutagenetix > Incidental Mutations

Incidental Mutation 'R5533:Fndc1'

433779

Institutional Source

Beutler Lab

Gene Symbol

Fndc1

Ensembl Gene

ENSMUSG00000071984

Gene Name

fibronectin type III domain containing 1

Synonyms

1110027O12Rik

MMRRC Submission

043091-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R5533 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7738569-7827302 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7772776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 696 (F696S)

Ref Sequence

ENSEMBL: ENSMUSP00000095036 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097425]

AlphaFold

A0A6I8MWX0

Predicted Effect

unknown
Transcript: ENSMUST00000097425
AA Change: F696S

SMART Domains

Protein: ENSMUSP00000095036
Gene: ENSMUSG00000071984
AA Change: F696S

Domain	Start	End	E-Value	Type
Blast:FN3	1	50	6e-25	BLAST
FN3	54	137	7.82e-4	SMART
FN3	156	240	1.48e-4	SMART
FN3	256	340	3.67e-9	SMART
low complexity region	377	388	N/A	INTRINSIC
low complexity region	579	601	N/A	INTRINSIC
low complexity region	646	676	N/A	INTRINSIC
low complexity region	766	777	N/A	INTRINSIC
low complexity region	868	884	N/A	INTRINSIC
low complexity region	1021	1027	N/A	INTRINSIC
low complexity region	1036	1050	N/A	INTRINSIC
low complexity region	1076	1090	N/A	INTRINSIC
Blast:FN3	1227	1276	2e-18	BLAST
low complexity region	1277	1354	N/A	INTRINSIC
low complexity region	1395	1403	N/A	INTRINSIC
low complexity region	1407	1423	N/A	INTRINSIC
FN3	1494	1577	4.32e-6	SMART

Coding Region Coverage

1x: 98.4%
3x: 97.1%
10x: 94.5%
20x: 88.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap2	A	G	10: 127,083,042	E429G	probably damaging	Het
Akap12	T	A	10: 4,357,405	V1405D	probably damaging	Het
Akap7	C	T	10: 25,283,982	D107N	possibly damaging	Het
Arfgef1	A	G	1: 10,199,727		probably null	Het
Cacna1s	T	A	1: 136,098,375		probably null	Het
Casc4	AGATGGTGATGGTG	AGATGGTG	2: 121,925,697		probably benign	Het
Ctsd	T	C	7: 142,377,333	Q274R	probably benign	Het
Dysf	G	A	6: 84,186,471	R1575Q	probably damaging	Het
Erich6b	A	T	14: 75,658,834	L53F	possibly damaging	Het
Exoc6	A	C	19: 37,593,770		probably null	Het
Fbxw19	A	T	9: 109,486,065	V143E	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Foxa3	G	T	7: 19,015,015	Y102*	probably null	Het
Foxn1	A	G	11: 78,365,966	M301T	probably damaging	Het
Foxp2	C	T	6: 15,197,120	Q54*	probably null	Het
Glra1	T	C	11: 55,532,382	E117G	possibly damaging	Het
Glt1d1	A	T	5: 127,691,031	D234V	probably damaging	Het
Gm597	T	A	1: 28,778,082	I290F	probably damaging	Het
Gulp1	T	C	1: 44,773,281	I137T	probably damaging	Het
Itga8	A	G	2: 12,160,350	V816A	possibly damaging	Het
Kdm4c	G	A	4: 74,315,649		probably benign	Het
Krtap19-2	A	G	16: 88,874,108		probably benign	Het
Lcorl	T	C	5: 45,733,877	N378S	possibly damaging	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mocos	T	C	18: 24,674,300	L363P	probably damaging	Het
Mycbp2	G	T	14: 103,282,645	Y745*	probably null	Het
Nav3	A	C	10: 109,883,678	N141K	possibly damaging	Het
Ncor1	T	C	11: 62,343,011	N779S	probably benign	Het
Nebl	G	T	2: 17,393,268	Y414*	probably null	Het
Nf1	T	G	11: 79,445,789	C1065G	probably damaging	Het
Nfib	A	G	4: 82,359,767	V216A	probably damaging	Het
Nub1	A	T	5: 24,702,381	N354I	possibly damaging	Het
Nyap1	C	T	5: 137,735,464	V436I	probably benign	Het
Olfr1029	A	G	2: 85,975,453	D70G	possibly damaging	Het
Olfr498	T	C	7: 108,466,262	F313L	probably benign	Het
Pde2a	T	A	7: 101,505,980	M570K	probably damaging	Het
Pfas	T	C	11: 68,991,470	S856G	probably benign	Het
Pkd1l2	T	C	8: 117,068,116	E368G	probably benign	Het
Ptf1a	G	A	2: 19,447,158	V323M	probably damaging	Het
Ptprh	T	C	7: 4,549,505	Y920C	probably damaging	Het
Sergef	T	A	7: 46,614,776	D229V	possibly damaging	Het
Slc1a4	T	C	11: 20,304,417	K483R	probably benign	Het
Slc26a6	G	A	9: 108,857,956	R351H	probably damaging	Het
Slc6a19	G	A	13: 73,685,829	T370I	possibly damaging	Het
Smpd5	T	C	15: 76,294,557	S42P	possibly damaging	Het
Snx13	G	A	12: 35,123,026		probably null	Het
Sox10	G	A	15: 79,156,302	S185L	probably benign	Het
Srpk1	T	C	17: 28,602,759	Y227C	probably damaging	Het
Stambpl1	T	A	19: 34,233,916		probably null	Het
Stk36	A	G	1: 74,626,591	R698G	possibly damaging	Het
Tas2r122	T	A	6: 132,711,430	T167S	probably damaging	Het
Tlr12	A	G	4: 128,615,863	S865P	probably damaging	Het
Trp53bp1	A	G	2: 121,207,746	L1537P	probably damaging	Het
Vstm2a	C	A	11: 16,263,125	T170K	possibly damaging	Het
Xpo7	A	T	14: 70,693,967	F304I	probably damaging	Het
Zfp286	T	C	11: 62,780,970		probably benign	Het
Zfp985	A	T	4: 147,582,983	K103*	probably null	Het

Other mutations in Fndc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Fndc1	APN	17	7765254	missense	unknown
IGL00590:Fndc1	APN	17	7765101	missense	unknown
IGL00765:Fndc1	APN	17	7772693	missense	unknown
IGL00904:Fndc1	APN	17	7756363	missense	probably benign	0.35
IGL01153:Fndc1	APN	17	7780042	critical splice donor site	probably null
IGL01557:Fndc1	APN	17	7756389	missense	probably damaging	0.99
IGL02493:Fndc1	APN	17	7775545	missense	unknown
IGL02501:Fndc1	APN	17	7765398	missense	unknown
IGL02503:Fndc1	APN	17	7771516	missense	unknown
IGL02887:Fndc1	APN	17	7773638	missense	unknown
IGL03348:Fndc1	APN	17	7772647	missense	unknown
pinnacle	UTSW	17	7773322	missense	unknown
spire	UTSW	17	7771480	missense	unknown
IGL02988:Fndc1	UTSW	17	7753523	missense	possibly damaging	0.95
PIT4466001:Fndc1	UTSW	17	7750374	missense	probably damaging	1.00
R0336:Fndc1	UTSW	17	7765107	missense	unknown
R0403:Fndc1	UTSW	17	7753723	missense	probably damaging	1.00
R0403:Fndc1	UTSW	17	7775588	splice site	probably null
R0538:Fndc1	UTSW	17	7784341	splice site	probably benign
R0646:Fndc1	UTSW	17	7741673	missense	possibly damaging	0.92
R1140:Fndc1	UTSW	17	7775426	missense	unknown
R1523:Fndc1	UTSW	17	7773209	missense	unknown
R1609:Fndc1	UTSW	17	7772766	missense	unknown
R1632:Fndc1	UTSW	17	7773200	missense	unknown
R1888:Fndc1	UTSW	17	7771789	missense	unknown
R1888:Fndc1	UTSW	17	7771789	missense	unknown
R2004:Fndc1	UTSW	17	7804929	missense	probably damaging	1.00
R2007:Fndc1	UTSW	17	7778748	unclassified	probably benign
R2128:Fndc1	UTSW	17	7778665	unclassified	probably benign
R2187:Fndc1	UTSW	17	7741772	missense	probably damaging	1.00
R2251:Fndc1	UTSW	17	7753607	missense	probably damaging	1.00
R2322:Fndc1	UTSW	17	7789015	missense	probably damaging	0.98
R2425:Fndc1	UTSW	17	7805018	missense	probably damaging	1.00
R2921:Fndc1	UTSW	17	7804875	missense	probably damaging	0.98
R2985:Fndc1	UTSW	17	7756323	missense	possibly damaging	0.93
R3436:Fndc1	UTSW	17	7750357	missense	probably damaging	0.99
R3499:Fndc1	UTSW	17	7753584	missense	possibly damaging	0.70
R3508:Fndc1	UTSW	17	7765108	nonsense	probably null
R3766:Fndc1	UTSW	17	7784421	missense	probably damaging	1.00
R3813:Fndc1	UTSW	17	7773322	missense	unknown
R3814:Fndc1	UTSW	17	7773322	missense	unknown
R4031:Fndc1	UTSW	17	7769752	nonsense	probably null
R4544:Fndc1	UTSW	17	7773544	missense	unknown
R4583:Fndc1	UTSW	17	7739249	missense	probably damaging	1.00
R4619:Fndc1	UTSW	17	7765204	missense	unknown
R4700:Fndc1	UTSW	17	7771480	missense	unknown
R4743:Fndc1	UTSW	17	7772279	nonsense	probably null
R4803:Fndc1	UTSW	17	7753706	missense	probably damaging	0.98
R4862:Fndc1	UTSW	17	7769735	missense	unknown
R4876:Fndc1	UTSW	17	7771639	missense	unknown
R5057:Fndc1	UTSW	17	7771970	nonsense	probably null
R5327:Fndc1	UTSW	17	7772708	missense	unknown
R5372:Fndc1	UTSW	17	7765210	missense	unknown
R5754:Fndc1	UTSW	17	7769753	missense	unknown
R5762:Fndc1	UTSW	17	7771534	missense	unknown
R5830:Fndc1	UTSW	17	7789086	missense	possibly damaging	0.87
R5924:Fndc1	UTSW	17	7773610	missense	unknown
R6147:Fndc1	UTSW	17	7753762	splice site	probably null
R6175:Fndc1	UTSW	17	7772647	missense	unknown
R6303:Fndc1	UTSW	17	7758485	missense	probably damaging	0.98
R6377:Fndc1	UTSW	17	7769735	missense	unknown
R6704:Fndc1	UTSW	17	7771810	missense	unknown
R6857:Fndc1	UTSW	17	7772170	missense	unknown
R6865:Fndc1	UTSW	17	7772840	missense	unknown
R7069:Fndc1	UTSW	17	7769735	missense	unknown
R7153:Fndc1	UTSW	17	7801645	missense	probably damaging	1.00
R7159:Fndc1	UTSW	17	7800931	missense	probably damaging	0.97
R7359:Fndc1	UTSW	17	7813486	splice site	probably null
R7731:Fndc1	UTSW	17	7773439	missense	unknown
R7743:Fndc1	UTSW	17	7765137	missense	unknown
R7884:Fndc1	UTSW	17	7773197	missense	unknown
R8071:Fndc1	UTSW	17	7772530	missense	unknown
R8100:Fndc1	UTSW	17	7771853	missense	unknown
R8317:Fndc1	UTSW	17	7800888	nonsense	probably null
R8362:Fndc1	UTSW	17	7782375	missense	unknown
R8835:Fndc1	UTSW	17	7739279	missense	probably damaging	1.00
R8841:Fndc1	UTSW	17	7773349	missense	unknown
R8912:Fndc1	UTSW	17	7800946	missense	probably null	0.26
R9236:Fndc1	UTSW	17	7773628	missense	unknown
R9392:Fndc1	UTSW	17	7773125	missense	unknown
R9412:Fndc1	UTSW	17	7772366	missense	unknown
Z1088:Fndc1	UTSW	17	7782479	missense	probably damaging	0.96
Z1176:Fndc1	UTSW	17	7773593	nonsense	probably null
Z1176:Fndc1	UTSW	17	7804877	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ACGATCGTTGACCACAGTGG -3'
(R):5'- TATGCCTTCCCAAACTGTCAGC -3'

Sequencing Primer
(F):5'- TTGACCACAGTGGCTGGAAGTG -3'
(R):5'- CCAAACTGTCAGCTCTTCTCG -3'

Posted On

2016-10-06